%PDF-1.7 % 2117 0 obj <> endobj xref 2117 124 0000000016 00000 n 0000004167 00000 n 0000004347 00000 n 0000005136 00000 n 0000005597 00000 n 0000005636 00000 n 0000005751 00000 n 0000005864 00000 n 0000006318 00000 n 0000006838 00000 n 0000008240 00000 n 0000008737 00000 n 0000009302 00000 n 0000009824 00000 n 0000010419 00000 n 0000010900 00000 n 0000011471 00000 n 0000011620 00000 n 0000011719 00000 n 0000011947 00000 n 0000012061 00000 n 0000012179 00000 n 0000015723 00000 n 0000018676 00000 n 0000022789 00000 n 0000025439 00000 n 0000025463 00000 n 0000025542 00000 n 0000069187 00000 n 0000069571 00000 n 0000069640 00000 n 0000069758 00000 n 0000069790 00000 n 0000069867 00000 n 0000072887 00000 n 0000073202 00000 n 0000073271 00000 n 0000073389 00000 n 0000073514 00000 n 0000073546 00000 n 0000073623 00000 n 0000076070 00000 n 0000076391 00000 n 0000076460 00000 n 0000076578 00000 n 0000076610 00000 n 0000076687 00000 n 0000079354 00000 n 0000079674 00000 n 0000079743 00000 n 0000079861 00000 n 0000079978 00000 n 0000080103 00000 n 0000080135 00000 n 0000080212 00000 n 0000085977 00000 n 0000086286 00000 n 0000086355 00000 n 0000086473 00000 n 0000086600 00000 n 0000086677 00000 n 0000086753 00000 n 0000086852 00000 n 0000087003 00000 n 0000087313 00000 n 0000087370 00000 n 0000087488 00000 n 0000093457 00000 n 0000093498 00000 n 0000093563 00000 n 0000093595 00000 n 0000093672 00000 n 0000101792 00000 n 0000102127 00000 n 0000102196 00000 n 0000102325 00000 n 0000185626 00000 n 0000186085 00000 n 0000186162 00000 n 0000186456 00000 n 0000186533 00000 n 0000186849 00000 n 0000186926 00000 n 0000187245 00000 n 0000187322 00000 n 0000187638 00000 n 0000187715 00000 n 0000188013 00000 n 0000188090 00000 n 0000188383 00000 n 0000188460 00000 n 0000188860 00000 n 0000188937 00000 n 0000188969 00000 n 0000189046 00000 n 0000191906 00000 n 0000192221 00000 n 0000192290 00000 n 0000192408 00000 n 0000192485 00000 n 0000192779 00000 n 0000193168 00000 n 0000193245 00000 n 0000193371 00000 n 0000193657 00000 n 0000193734 00000 n 0000193766 00000 n 0000193843 00000 n 0000200146 00000 n 0000200471 00000 n 0000200540 00000 n 0000200658 00000 n 0000200735 00000 n 0000201035 00000 n 0000201496 00000 n 0000201573 00000 n 0000201918 00000 n 0000201995 00000 n 0000202314 00000 n 0000202391 00000 n 0000202710 00000 n 0000206714 00000 n 0000217256 00000 n 0000002776 00000 n trailer <]/Prev 5448191>> startxref 0 %%EOF 2240 0 obj <>stream hޤTmluu^;ݹ!aA1 Ѐ i4 3kٿ]] (0&oK|0MPC1&c` &&>vo'~/yr@= U@ =5 YhJU%M",/:W>jlkcY"5Jύ%G=4 R 5_ajMNۺ?v&ߎw?PP mK92wG##h |B?h1:Jޘ*X̾:z|x,NtyRѤD#L6F!2qU:َ{./fܬRK~|GH^ c0=fFfGFMχD4edfN`EOaq圔=?d Qp$*wQ`|<֝_ aㅕH[(IJb7W4т%\Lr2:B>fߕYetr\2&@c<04L a:grDzz05z}[wF%C\0[HTeupO( 4FlLf)T(QĮrW}:Nw<\pFODZ SlBRxL42ުUt:xȴWO~3*Ϥq--[S,f]K˶8Vznh5 EjaiVLEO)mHxg!]sj4 uNgPi`4^BZ=?*>ͷ+iT?燙:F|jfY?UpJ}_|esRGzǡ !JDMv;Ug}sMKHf. Ģbvո* >B-Jc + ZfcXۓlOt6i"I,e+`~g{g$ISWaN *TH 4@a)wA20-sCYBυ8T"0LgwQal>)f|Q !! is,vmv 9\l,\UY)[<η2iU^74LJc$Y+x̣`1v G=Q,xJmcX[gwk䊇rhj})g.@ChRW`˜o7= endstream endobj 2118 0 obj <>>>/Metadata 2115 0 R/Outlines 2085 0 R/Pages 2110 0 R/Type/Catalog/ViewerPreferences<>>> endobj 2119 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC]/Properties<>/XObject<>>>/Rotate 0/Tabs/W/Thumb 2086 0 R/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 2120 0 obj <> endobj 2121 0 obj [/ICCBased 2141 0 R] endobj 2122 0 obj <> endobj 2123 0 obj <> endobj 2124 0 obj <> endobj 2125 0 obj <>stream H\n@<C 3,9v"?Z>~(+-CP3_YM}7gCܩ-5eڮ>RYn:˾? YU=N6pY#1u=]~G~r ^6loDϱ}kϻdo2X719fŽXgo{.+ƎNYU.ƞg_[#WX,%XVrf̬ + ¬Y %]]]]dCހKKKKKKKK'WʎJ_W+J_W+J_﹯Ǿ{yzf=>stream HWmOF_m)ᎄ6ܢ**zDABj~Yw QB;ٝgJ(I8M1zvbwCݣnڽhz[AONYM 6nP^ 6U6{UU5)%&1+rnKahfo:o2D#4Lʀó"Iܼ jN䤁|?zc5$}VAꐼK 40G *逳N&~#A}}_dHtmSHfK:Y`k7ј>` F$F[Q@{pB؟6Y_*f~feQ+T SV ̂iU<IbCxV+D-%/L*(`ktMn^I⃽OlP/AXJ+۸m״uPxOvx:1P#nY$19 (bFJK( A2A ^: !$Q[IŴɲhQdd4^X Gyj| ث$rI򦿘E_!K H2qXiSY |Ɉ5B؜c[[1^ -]Ʃ3р B!̠[Y/rŀ[k NY9\1|ԠptX(mFʧ%qml?[;Іp׭l*tȹt렯. 2؁F"v6x̍RTͯmIr7u+CFЯ eY>?{T [~)fJZU-?^-ZąJNd$여"$}TC;'cq|:T<4뉃>.` endstream endobj 2127 0 obj <> endobj 2128 0 obj <> endobj 2129 0 obj <> endobj 2130 0 obj <>stream H\͊@>E-I7d1?Lfh%-tTYhqn}.9 !mj;s'yڮ?RI9\iHʥ<æ1ILml.=#\B?̭׮ ѷz^_KeO6S\1b) mu?v[> endobj 2132 0 obj <>stream H\jPE>=$&-a27arcs0B=&'f840c׷1\kl;Sgµ]3}^͹< o)wqȪ?onp Ofus'pk1G=yaצt{H3O2ІX7!)d"+Wc;?u̪/ye"0 2W%gK̖K%r\ %0 2+1gȏ̏OOkuB+ B+ B+ B+ B+JЕ+AW®] tJѕSTx*=JOSTx*=JOE?~ kkkk1cЏC?~ 1ُG?nEc%溯}k1U{1lWׇq]''V endstream endobj 2133 0 obj <> endobj 2134 0 obj <> endobj 2135 0 obj <>stream Hb`  endstream endobj 2136 0 obj <> endobj 2137 0 obj <> endobj 2138 0 obj <>stream HLyPT_ۼwK4rqAZ A -.dXmhD%2N0b*h- QvEM1 qw$NcrQgyuwιOyT*ՔU脙Ks2y!QАlu]VQV^MTyv] Ejah=>it8nJ o CyCY Ů,%0ך_lXi2 \YLŮ<[~^lsβč6Xr8Mp<[\%q{,nqUUV=jQ_Sԧ<={|+w!Oh!I'JRsRS7ϧ^F^{xۼzWz7ycfik۵)">QhjXg Ơ://7"f~UvIϱHҷU]ps)EX(%N`g8q̈́`~mӢM(&zzj⨈[x)؋It(_y1x΃@K_I/ oBtUVtYM] c4S{@N,Y:Nz2wѕwT ?HtTiIb-tu eI+'~HDDb 0o0J/P"xzxh= ꁗpS!?ް 'jf,eQeIϴӽCpб{ 8 *wMYd?}@_iq r[Y`_CAM՞~^iSq2-ilEP"%+~C/U~+mz1O%ߗn;n@t|K50G}!F#Vȇ`ttږiׁK*r^/`܈tM*6btYdʃ0~ 8)}hN*r.'N)挍UzT[r-U L|SH[ CЛ {,s*Ji? x!L'W\,?wVŮзڮ+uiTYXvEz$zZdϯ pr[%kL''ƒq7R+{51Eu|,A P<z )E-!p-R/(TgZ5t?ALhix+s1P7$;zA9O\ * :S.[\06G8 L)s Nxj{\_gX2c ]Hf,J=yQ }Td.>ecvaV*0lN8ݟ!HrGʔ(+?_=~͋ :[L?Fpb!W61@~XTN7MNj8σ~xÉD|V(*Aþd՗mn$>3;>Vk>stream HLUiTTw{?6/ (B¸DYT$0uʀ3 JkcX1  p\(D9.uNV"QK~gwyymXA,;3J;'<;ǐc2 ?"͘lNNKI5 ?ɛ"'ǥ &rS =Nw5Me,~+ ׼h4 jbR5kswd&kb s59¹lVj4͛g6ܜZCNּM Ɖe\ü`|eV1j c(I,; lv-b;FYʃʛqPSsA\1W#J@E莣j6NNNݜ7:9.H6ƂmdVRA 5>\Fo+Z \uzջ7&b ެ_@5w`XWWyc 8dn~eXMbzA>]chAn_"fo>>R3uꪘȆGAߦ!3qW8Vj&#*}>/Q="D Y}7S8=Q-ŧ8? UN>uW -ޟ"gvϽH[ ؖQ%L?*?LD &SFMV (' E {L|@#!0F ymD"R  ZM)MG҇@$-d |?4NhNX6`׊:s'Vh(HW!TۆgmBK{zbXBF|t/O P _QAQi=ɻZyz/J%CC_jȇfcஔ`lj[_ln0Z\#5SL-*ǟ:Z]!fepo8^e(ly.RLf QsUmggenց&en&Dt_aR?uJ^b7 /jq@jۆ7HkyKP^J{aN0('(I,D@}E_kGZ2˰cJx%]m%w&6! wi36aKVFH^-J7e'X׈PcE]G%'8q%!?9_x,'P͖ 4s\K<3}BD I ȼR˸2E'eXrdeWX"J_P % K\4ȧo (zȤ՞d$RS9A'\Q_I-'|J)I$Jꞔ{ޒq*7[V֐q+Pሎ)%3_CZf$$8G > > j9NCcyI5D dDq\+9험x|,& ƚ ?ֶ$,\M(cdEp@O{1>QWz&{Я~EjZ<*?-z;(χJԇ?Qc4-|6&{ȗx='}v訚,0|~`<٠mt8b'Nt{~8w}/U5_T=F.k?SIm,7\21E^O.5y)3`M[z Ijj:W !|k9OĪMy t/oCk𷯰P]jN@(-ٻCF4meЊdszF+d4Da NXMt8^1F9"j4F%A-޵дtM?jRhhqYo#J4F\cLVթi这|{{Y4 }p ̣%QzIa^&/qǣ EĽܚĠ >Yj(/DO$<`;izB$ϕʊ$ 4BF pՕgl*T?d&.?g)dٳTUu|| yeu%F-Zkc+d"0(m2V9!:`#dƳƩ V螌XQC)GǕtb;L\kW4 \OTwRQ"@D_""a@J(9ޒY{V)}]i%YfxN({Et NYoh#atnm٭Fr[6479c֤g'l\Э={.O5a7Dhӕ*T[(G9$)I-/-ЖpvZ@ܾkx*b+P_SMC$w 1H !!#$%͑? k | endstream endobj 2140 0 obj <>stream HDUyPwf (hQ"" #`*b Qq`hၢCQWA<*n$Z]ļ&רI?3=}w4Ϲqyʂ{z{~ԏ"B.,˺yjX2WF+~2:w\=:Xa~>}87OHew&iZddHSRbYM)ΞdkNz)3/RPPa_\nK 5eXdz$n pr &.-H2kKjz=74EqNޏ'kB[t7[fYƽ!@#Fq''fJ}8E{#cGphZ߼F&캯uY: [GE [7þkA 5A`t~sFn&.F͏q1T ), jCLXk~vdc98)j؟a1 IB+툵ꋃu.߷bWE;+QȾV:n(/J?ڶ#l]՘]e[ܾ2zT5mn)(ro).)޾Q۫(>誩wi86vmʲcNmk16ؖ%UWj%_AB7 \ "wt%}|#FT?cq0JYVP/IDpb [qfG.}:% t!dp6X!Hzb`NI7PxBZ[\V*alìȠ`@lb,gJYdpgaeO#Dڏ6v:RR֯GntA'ϟ.}b| ba|ܵ^HSa">6CTBIb|RnL]&g{ΑL,g/1E&?[l2gr+GbKMAQJ+YwϱI9̤829M)"\M4#Oш"CxQo(ョlhŏf*@uh6B .f~t?w#$û:[Q*a0E| ñ=N(A=' ~ʠXh`F@8R0C[a&đ2;t=R|z+] 29S)&u_շ/*ۦ!Q*v0 G Da ;7R% Ca>UvtBऀD :ޢ$O@uP=>6%hWξdaFuI49#P /' BuܢPvG/ضZWX\M{_`qesI#(ȧƒi/Ke,)U5BĶ.*UQI!14: Dj ɷ(Y {&y"ƻQIAIHPzb]sy_â*\MlOCRA$(1 Χrĝ3Fȣ-S.$@4ġ3M=~617Sxz:Q\n$Kal{@Ώ^Jhέ'mЃqC&:{*\} D4Ĥ^,Hwfq~s]i- EkcW:W ba8|4.1dGgF!!ΈmYPϲN_c3e>TӴBCV"]i(KJ6CG=B:7nԹ28e i8qꐜCF*6T5(@Ic%LBw+j4@dv_V6Kvnℚv9Y QksKMV܀׏b3IzAD|rx=;ӊ0&^?jGxKn@>;x~iUK7(e9atq.HI'E !|C`*.ԋ;QIQV֣; LX-Lr+EJP:!A h]>br^Qtv nnQ 0A "%.ddXڱC3W_ $E> & p%d4t)\Cc!WS7nuҏMSi,GPGqz'x#NMB61<Hb._s} aU5&CjkD}VKlo NTUr̹rX^%3.O*t=ff||FыWTҶfl=- -|@5fd37:e.TaS+z+$F'[>0l*7I-^v.,>%wC-<*Z;& { 4.b;l<% 95/sc'RN%DAی Qd粄(W2Nm3GUM4{&"(f@lN$ESti jgMv,*$Tk6Jy=xXPVrߏ~tq7ovmiŻ,ZpPBo^ maY_Kߑe v\XB")"6t(."p3x"fֽjh#tLGvXZLEHt_ 71ċ ̈__ޤx#^B.;nJז,T11 RXM nG:-i!w+_$C/6D<$7UKJMlö?oc1/qJi7^Gv endstream endobj 2141 0 obj <>stream HyTSwoɞc [5laQIBHADED2mtFOE.c}08׎8GNg9w߽'0 ֠Jb  2y.-;!KZ ^i"L0- @8(r;q7Ly&Qq4j|9 V)gB0iW8#8wթ8_٥ʨQQj@&A)/g>'Kt;\ ӥ$պFZUn(4T%)뫔0C&Zi8bxEB;Pӓ̹A om?W= x-[0}y)7ta>jT7@tܛ`q2ʀ&6ZLĄ?_yxg)˔zçLU*uSkSeO4?׸c. R ߁-25 S>ӣVd`rn~Y&+`;A4 A9=-tl`;~p Gp| [`L`< "A YA+Cb(R,*T2B- ꇆnQt}MA0alSx k&^>0|>_',G!"F$H:R!zFQd?r 9\A&G rQ hE]a4zBgE#H *B=0HIpp0MxJ$D1D, VĭKĻYdE"EI2EBGt4MzNr!YK ?%_&#(0J:EAiQ(()ӔWT6U@P+!~mD eԴ!hӦh/']B/ҏӿ?a0nhF!X8܌kc&5S6lIa2cKMA!E#ƒdV(kel }}Cq9 N')].uJr  wG xR^[oƜchg`>b$*~ :Eb~,m,-ݖ,Y¬*6X[ݱF=3뭷Y~dó ti zf6~`{v.Ng#{}}jc1X6fm;'_9 r:8q:˜O:ϸ8uJqnv=MmR 4 n3ܣkGݯz=[==<=GTB(/S,]6*-W:#7*e^YDY}UjAyT`#D="b{ų+ʯ:!kJ4Gmt}uC%K7YVfFY .=b?SƕƩȺy چ k5%4m7lqlioZlG+Zz͹mzy]?uuw|"űNwW&e֥ﺱ*|j5kyݭǯg^ykEklD_p߶7Dmo꿻1ml{Mś nLl<9O[$h՛BdҞ@iءG&vVǥ8nRĩ7u\ЭD-u`ֲK³8%yhYѹJº;.! zpg_XQKFAǿ=ȼ:ɹ8ʷ6˶5̵5͵6ζ7ϸ9к<Ѿ?DINU\dlvۀ܊ݖޢ)߯6DScs 2F[p(@Xr4Pm8Ww)Km endstream endobj 2142 0 obj [0.0] endobj 2143 0 obj <> endobj 2144 0 obj <>stream AdobedC  "$*$ $+(( $)%%1/%).*++9+*./45554/;;;;;;;;;;;;;;;;;;;;;  9 U ^C !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?ЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪ endstream endobj 2145 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H,A @ yE@MfL/,Ń0 MBQ8 jd0~FZɆ2JjC5 rRP35XudcBzR7ׇ&- endstream endobj 2146 0 obj <> endobj 2147 0 obj <> endobj 2148 0 obj [0.0 0.0 0.0] endobj 2149 0 obj <> endobj 2150 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;;J L RQ2! "#$%&'()*13456789:ABCDEFGHIJSTUVWXYZabcdefghijqrstuvwxyz?ЕOzl4eTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTfe3Mm)2 Rd)IR &AJL)2 Rd)IR &AJL)2 Rd)IR &AJL)2 Rd)IR &AJL)2 Rd)IR &AJL)2 Rd)IR &AJL)2 Rd)IR &AJL)2 Rd)IR &CVm٭Koiԕ0ضwcSjQlŶ'ΡԞ,ֱxtYՕ3*ئl{bRlƶ'gmK(WkXs>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/2P0B]C#S =#S3=CsSSK C\.}\|@.9 g endstream endobj 2152 0 obj <> endobj 2153 0 obj <> endobj 2154 0 obj <> endobj 2155 0 obj [0.0 0.0 0.0] endobj 2156 0 obj <> endobj 2157 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;;  1!2Q "#$%&'()*3456789:ABCDEFGHIJRSTUVWXYZabcdefghijqrstuvwxyz?*!B!B!B!*!B!B!B!*HG"5MXɣ +E)dt*M1(iT4idvcJEY%HT"*q ;ҋ14!J9X)J(hdJ$EXɄ#YGQd#! :2edr'F%*ig%J(D!B!*zd32*@5f,ETU;I(A1fFR>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/221PAC3# =K# Kc#c#s=cKsC33\.}\|@.f. 4 endstream endobj 2159 0 obj <> endobj 2160 0 obj <> endobj 2161 0 obj [0.0 0.0 0.0] endobj 2162 0 obj <> endobj 2163 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;;% ( p'QRb !"#$%&'()*123456789:ABCDEFGHIJSTUVWXYZacdefghijqrstuvwxyz?Е XD_]&3I`$mX6,D K%hI`$mX6,D K%hI`$mX6,D K%hI`$mX6,L'G"O&M,XѕQ`͉޾MUI>F "GA)1a(>qC}'P:I8Nu>qC}'P:I8Nu>qC}'P:I8Nu>qCr>Gx~ZOa1Acbp?ҕ4:4w"(ďd}wIQu 2FA(:P dBQu 2FA(:P dBQu 2FA(:P dBQu 2FAeERz_=o)1<*rӕR=1Mb'>F`uHHHHHHHHHHHHHHHHHHHHHHHHHHHvX0E"n H)19OԕR`{3e4J[en>;Wܔ?fRH)19OՕR`{3e4J[en>;Wܔ?fRH)19O֕R`{3e4J[en>;Wܔ?fRH)19OוR`{3e4J[en>;Wܔ?fRH)19OЕR`{3e4J[en>;Wܔ?fRH)19OѕR`{3e4J[en>;Wܔ?fRH)19OҕR`{3e4J[en>;Wܔ?fRH)19OӕR`{3e4J[en>;Wܔ?fRH)19OԕR`{3e4J[en>;Wܔ?fRH)19OՕR`{3e4J[en>;Wܔ?fRH)19O֕R`{3e4J[en>;Wܔ?fRH)19OוR`{3e4J[en>;Wܔ?fRH)19OЕR=%),bOo}YAv(1=1 E,)6~̤믒Rbrѕ$a~;`$JC;Eǹ>`v%'?(&ٔ=uJLNSҕQbɉ_Ly~X0X3=4XD4#Pv(1=1 E,)6~̤믒Rbrӕ+<ߠDz~+E3ܟAQ|Q$f3` l6̀f3` l6̀f3` l6̀fqAoJ)aIe$]|ԕ#}w,"g?%lPb&{,=XD\*H$W +I¤REp"T\*H$W +I¤REp"T\*H$W +I¤REp"T\i(EL'>)"L?Y0I&'|ՕqE&'x,"g~{ؾ6Q3>,Q`*;ĥ##zF9r7oAރ#zF9r7oAރ#zF9r7oAގa)j0c=m<&ʼn㒉8֕(7I 0EI%¤RIp$T\*I.$ KI%¤RIp$T\*I.$ KI%¤RIp$T\*I.$ KI% _|SM1Hו 6!͈f3b ؆lC6!͈f3b ؆lC6!͈f3b ؆lC6!? endstream endobj 2164 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/54S0BCKK##K=ScSc =Scc CC\.}\|@.} endstream endobj 2165 0 obj <> endobj 2166 0 obj <> endobj 2167 0 obj <> endobj 2168 0 obj <> endobj 2169 0 obj [0.0 0.0 0.0] endobj 2170 0 obj <> endobj 2171 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;;W i Q1!RbA "#$%&'()*23456789:BCDEFGHIJSTUVWXYZacdefghijqrstuvwxyz?Њ;r%NL)2RdI%&JL)2RdI%&JL)2rr%NъzMmڊ*Fۛ81n3f1n3f1n3f1n3f1na6^ 1>}] NSS ҊoW.*cYؾuQ‹LƆ󰹱Ǜn,yǛn,yǛn,yǛn,yyZ1DpY1^p)׬igRuZӊtS\ý;0TFtLFȫC2.,ȸ"̋2.,ȸ"̋2.,ȸ"̋2.,ȸ"̋N,iq\Ux*guU<ΦgYSΦ_6SSԊt +zLWa] LC`4USZfqk\fqk\fqk\fqk\5x$Lh|V1/֝gXU<ΦgYSQU/b?ՊtL=>)ө{|Sڗ*cPUPUPUPUPUPUPUPUPU|Q05Q:5 y\cU3^ :gYKG1-3֊tL=>)ө{|SRv: Mo5P5Q:3}u<0*tV 135t4R%&JL)2RdI%&JL)2RdI%&JL)2RdI%&JL)2RdI%&JL)2RdI%&JL)2RdI'.7"\T׊tL=>)ө{|SRv:  5Z&CK`qycY]5γ^&f3qc7f3qc7f3qc7f3qc7f3qc7f3qc7f3qc7f3qc7f3qc7f3qc7f3qc7f3q'j9۟>TTЊtL=>)ө{|SRv: ^Q\><#TN0WW\γ_}V'ŏ7)ө{|SRv: q0׫Vipxmφ۟&DS"d\YqfEřd\YqfEřd\YqfEřd\YqfEřd\YqfEřd\YqfEřd\YqfEřd\YqfEřd\YqfEřd\YqfEřd\YqfEřd\YqfE5x*_LNaULjx_4ҊtL=>)ө{|SRv: L1Emzshb5.3Xb5.3Xb5.3Xb5.3Xb5.3Xb5.3Xb5.3Xb5.3Xb5.3Xb5.3Xb5.3Xb5.k "u[PDv2U2Lk#ӊtL=>)ө{|SRv: QTATATATATATATATATATATATATATATATATATATATATATATATC HNx5OaZeΑԊtL=>)ө{|SRv: t:;D8Ѫxi^s /tՊtL=>)ө{|SRv: t:;D8Ѫxi^s /t֊tL=>)ө{|SRv: t:;D8Ѫxi^s /t׊tL=>)ө{|SRv: t:;D8Ѫxi^s /tЊtL=>)ө{|SRv: t:;D8Ѫxi^s /tъtL=>)ө{|SRv: t:;D8Ѫxi^s /tҊtL=>)ө{|SRv: t:;D8Ѫxi^s /tӊtL=>)ө{|SRv: t:;D8Ѫxi^s /tԊtL=>)ө{|SRv: t:;D8Ѫxi^s /tՊtL=>)ө{|SRv: t:;D8Ѫxi^s /t֊tL=>)ө{|SRv: t:;D8Ѫxi^s /t׊tL=>)ө{|SRv: t:;D8Ѫxi^s /tЊtL=>)ө{|SRv: t:;D8Ѫxi^s /tъtL=>)ө{|SRv: t:;D8Ѫxi^s /tҊtL=>)ө{|SRv: t:;D8Ѫxi^s /tӊtL=>)ө{|SRv: UL&!C8/^ x2e/^ x2e/^ x2e/^ xaIO:6*1/U̼:HԊtL=>)ө{|SRv: Lu>jL"#o|lFѪ{ 1{F/-bыF/-bыF/-bыF/-bыF/-bыF/-bыF/-bыF/-&1/ygF']pZ]&5̾Y?ՊtL=>)ө{|SRv: q2׫#Sp>55|'L LqTisgf-vbًgf-vbًgf-vbًgf-vbًgf-vbًgf-vbًgf-vbًgf-ki|ָwSa0}ʙuԺ֊tL=>)ө{|SRv: İ|XE)ө{|SRv:  uZ%=4jb]6F']10Ӯ~33谜.fg]j/&^Ly2eɗ/&^Ly2eɗ/&^Ly2eɗ/&^Ly2eɗM,fecX?ЊtL=>)ө{|SRv: UO500.51:5U뼮1ëy/ TλZ\ъtL=>)ө{|SRv: ꦧMK Sxw8}uNg]RW-.ҊtL=>)ө{|SRv: c2KI £SwX}uΪg]RMnӊtL=>)ө{|SRv: M%%P밼&51:?puWc y7 TλTmV ԊtL=>)ө{|SRv: -TXDjbu0êyle4Ng]SNejUՊtL=>)ө{|SRv: L|8Mک0K±U:c:10tV:w_II\̀?ЊƗAaXFkƦ#]cXw*g6lElF[lElF[lElF[lElF[lElF[lElF[lElF[#biW:+0cUL+ Tλъmj}t4pQf6syjM7ZyjM7ZyjM7ZyjM7ZyjM7ZyjM7ZyjM7Zy8ok)R;{§U*JYҊ1,:54 SyMu7gSyMu7gSyMu7gSyMu7gSyMu7gSyMu7gSyMu7gSyM' jvU$ ӊ++++++++++++++++++Ԋ endstream endobj 2172 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/24S0Bc3C]C=C M lKss\.}\|@.o H endstream endobj 2173 0 obj <> endobj 2174 0 obj <> endobj 2175 0 obj <> endobj 2176 0 obj <> endobj 2177 0 obj <> endobj 2178 0 obj <> endobj 2179 0 obj <> endobj 2180 0 obj <>/Shading<>>>/Subtype/Form>>stream H*2PHwR\ `l`higiiaifd`dg```infaP` endstream endobj 2181 0 obj <> endobj 2182 0 obj <> endobj 2183 0 obj <>stream application/pdf Hitachi_TM 2007 Adobe Illustrator CS5 2012-02-20T12:01:19-06:00 2012-02-20T12:01:19-06:00 2012-02-20T12:01:19-06:00 xmp.did:B0CA962109206811871F8A4B9F8B6BD2 uuid:6810747c-3e4a-5a4b-aefe-0bae8ccc3d10 uuid:29EEF1EB347F11DDA7A0B5DDEB6F260A proof:pdf uuid:1a3162a5-da51-4a51-a155-35526b76f090 uuid:29EEF1EB347F11DDA7A0B5DDEB6F260A uuid:29EEF1EB347F11DDA7A0B5DDEB6F260A saved xmp.iid:B0CA962109206811871F8A4B9F8B6BD2 2012-02-20T12:01:17-06:00 Adobe Illustrator CS5 / 1 False False 11.000000 8.500000 Inches Magenta Yellow Black Default Swatch Group 0 K=0 GRAY PROCESS 0 K=100 GRAY PROCESS 255 C=0 M=0 Y=0 K=0 CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 K=100 GRAY PROCESS 255 C=0 M=0 Y=0 K=0 CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Document Adobe PDF library 9.90 endstream endobj 2184 0 obj <> endobj 2185 0 obj <> endobj 2186 0 obj [0.0 0.0 0.0] endobj 2187 0 obj <> endobj 2188 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;;Q 3 3a2Aa!1 "#$%&'()*3456789:BCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz?1qs<EeϷm=8v1F#b1F#b1F#b1F#b1F#b1F#b1F#b1F#{>MpA799~c1w1wEdϷp8x^83838383838383838383838383838383}8Zamr,1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w0cbm|@y{ 07Ag'-g%1w1w5آDg|v/l 7Ag'-g'1qEeϷl8v^0L& a0L& a0L& a0L& a0L& a0L& a0L& a0L& l> p7A799~c1qe6]X,{/Ӈa`0 `0 `0 `0 `0 `0 `0 `0 <뱲elcr2%f6\lˎca&> ,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2x!0]{ P`sl1Ac>6Xl!|6>{P02(2(2(2(2(2(2(2(2(2(2(2(2(2(2(2)f bL8mAr6yB#l0G` ,6X>;P>/N/&Id&Id&Id&Id&Id&Id&Id&Id&Id&Id&Id&Id&Id&Id&Id&IلBh 606l?1cCb $&h_ :>;Pt|`hၣFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF<4{p@كGpCm #aE,H/j/w7} Cw7} Cw7} Cw7} Cw7} Cw7} Cw7} Cw7} Cw7} Cw7} Cw7} Cw7} Cw7} Cw7} Cw7} Cw7} Cw{pK0]pZak #1!ĄϷn ڗ/hnhnhnhnhnhnhnhnhnhnhnhnhnhnhnhn[P-o'φӆ ׆ N&FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFN<tyل}va;ѣl{[ 7 7 7 ' ')(2(2(2(2(2(2(2(2(2(2(2(2(2(2(2(2rOnOno~o~ Ҧp8v^;^ 7,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,2̳,yyy{pl=6^/Өp=xv^8v^0`x`0 `0 `0 `0 `0 `0 `0 `0 `0<0>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H 1 0 =LjI]([Ke#k&уBCj@a5|kR'x{_O endstream endobj 2190 0 obj <> endobj 2191 0 obj <> endobj 2192 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   %%#(((((#,0000,7;;;7;;;;;;;;;;   %%#(((((#,0000,7;;;7;;;;;;;;;;'4g"   o!1"AQa#2qR$34BbrC c%&'()*56789:DEFGHIJSTUVWXYZdefghijstuvwxyz g!1AQ"aq2#BR $%&'()*3456789:CDEFbGHIJSTUVWXYZcdefghijrstuvwxyz ?{4Ӥwu{4׳Rw5kW.]s5k%W3\zrvri5˹^\i5˵zJ+OJ#9+>˒m8$FEs4Sf- ݸ^*<`b^V膜Jg8JeT\yԠ2)j^ql W+⊅+=EEӣt'H$(D]SHG0mEI T*$HUFqn4 y a#)mvE}yXOf+kk}tmڧ>trmcnXdVUf]PԞy=cU}*6bcAq~h%W8{":suP RW]8Dc+4H"TNt PT(Wq\uI1+j.1WX PPm2MpxHU*b >EC3 ffj7Qľ1TPinieaNjԛy*t5B qn]cTzh1O@Ueb\&ܓdMn0&R$v%SV>!ln*l W^˶oU1R} K%v-OMJ. ^<jWb0ڸͰ1NxR+Wj1\*P sm9\P\'ZZ`W. 0 W]#ʕszO4?hoZtˎJ*08_߰ 큓jD9=7 mm,q_Х{5;J^\\^\\W/Wˢ\W.]^\]k% $R/W٤\trqҞΘ>+JKHbz%WHc\B`G[ !1Rɐ meƸKK据UQђ1U1ևv.x#QLd51I3GJvꪖ]I 1i)JqcJR^xZ]BеWUUrzk/I^ e)3Rt# !i[Epbk RI&Ms5˗1^&[ʥBm3,M{R>*)FMK3B*L&C>I8p8S59KN.|";M4Юv9G:{ﳰ£isTVWVʤ$VȬZq 缷XA9>.c330HlzKH-S NЁM2Gq2dȉ;RKm|G zW &αi -,H󮉅WqUyY $ܐx栛 BNY25 R)e\ݸIQn|.=<ɩ:\vqA֤VLK]:!Mc5ye̍ $9K;`tKo+c!QMJO\.!gWM= 3W T/VSވБUbsI2 ʣ9Ry,p=*$*jcI&S;&gfsI5ʰ %p1]T_ӨJT.8jAH'N%l]UF*ј_#*ϳQ79$ӠItp#PTe}vKU!ҚYZ%d"A=q 1J8T-M")Y@UǏ*4g@g5`}Ґn1j!r%9Jyج;xxJ*%׊S}u{+I,LsPfK9) 8ngM{AŽp*>p\dg#$d斘) OJ" @>uh{;k.y]hkN**-3AkO0Z%'scT[*TvXW/;R ]9Vpd?Z$WҼmqUٝ[ch7(ϊt䴌 =H; RL*8˜i#(Ik}ǚERB*)\R@n@*/jSuUL䕤6qW򦤀5uT\s\tr09,@9+Bd)6+JN]'mt=t.MtMWI4Z+Jkее.Iriݴ]+͚F*KEHNjd**V w5WUk3 oWm'; N]i{*բp*,oHf}+K,#o@vMfKfEtVq*'{hTkQhn+UKzdyͭ޳68օDbʠ"AϦA؛<F[=<6m-i!} ̳7֗:3DgU7n2فEx?',Jb~P-~eq,VmY:x ScNc HV28rJYkK'}gkP0ʏ-'z:6֛Y6He&utzyQ;$'QnuE8y>B˨dii;F k41\8UJҢ՞G5mO(ZpEG<0|]n8ljᓡP4-j+IsFGB~KqLZBNk꺪kJ+.WԲһ7r1l>B!("KTP8Ԫ600@] Uݫ^ KCWH()%iI˔vIݭXLf93ⴢV͡uQ>z5i҃Rͅq gUF*Z])鞢0RIن'X Wx8RFkkr䝵ݕ W.^+IjqR/"yL˝敼WBK'dR{.]p*$ď֤1x٪Ur g&KH<{x^B)ҝrQHyi|Rn ̧Uj;xl4R. ?'2}ܚ-do+e;](F-ȡ5[z*;\N\U`XNKy(MB?|TYuTwP't)SȀv6y"] ǚ&t8{)[@YmwfL ƻ7IlI4f=9o *H G3] OAzz~dH|>83ld KQX~T)AM@`JhnLyꆫN<]~6WsXMc=zҲ(e+ǝ GZts<ȩU!"9h߇_gڤpwV`5XO!#c>_1#J: ;*~Zz%HԂé4bdރ1jȄNESX6~F\K=Ӄ^ >z\ZAG"/+#<MI:9~7Ӡ֟٪0FŪ]M%9%ϗb iAJbgfI^JwˇM/T^W˗+b\rzA_PSShE/pP]#u{p\i$ JpIaMG S /'KlɃMy*QQ,"M[NRa'Zz xKn DkQ/@Ac7WnI^~ړkćzzBjݜ((j+@☓쪖 Rw4lsUVJ&Mzk$Hrq^yO=*֩nUeSQaXRE9q4vH|S'i^uw,22N/sT8|vVfA⍊SHuʎ<4nWZ微rW+.>sTp1 @Ⅴ1cŊRv:DRts|GTE2j|C^[-*VvP}ų.T?|9O1PJ\Pȅ+H҃^-psIfsI =k'A՛j϶{z>*$i(k$кW\Oi܃֚IϝJVzuSh׃?*RܾpA$dʑj; zJ-Uv>p96>Tp|^?*}qCQ'% ha; SH۟mD[ Gx_bw' ? TQyxsF7H -(- ˷?WkZS}Tfj2†m 6w1P~Q$4ȸ3/WFgϙ$,l3tQ`hNN9o;E М(kQCਰ0EF#`}XC4EOך톓:f>TUӹ֯o(} ُbIKe^[Ϋ'(F4HIsϝsiϺtrh*ĦebW]Lo,Ҷ9m*] YIO0zXe:0'ϥsu\v_M$u<|z04̠džO2gТJyIJI}4F85oTg+JFQ ǟ'=>cL_X{rΠ;Rl1g9SnE**;?5$5s{d GA RK9WHU Lt5aHTNEˀ9]M|4z ~ ݰ:~\wVVPcvSa.3I#4Knex98Tq[ NvҖvA$x4Xo4  ly*i5]EE7ѯF>SeLdB@cս޹q"tUBAbO8W5|Pevjeh[ěќ#t?Y\0$4?=FܤJN[0G#!d]y\YC(as|]8D 2xzSH =A V- ]#3hҲ}\ 4 Oͱ(G柄T")ƅA2G$E?Pfx|"p^oV%&HLbu"NIkYAIb^RrW]brMr^r+W._rS`|gVqj 9pM_D\ʨnNǶT%ef>Ta.uһS&`r<$&@ $l1TF&*2sқ3JRe:ƑdkkڡH8NE(AA4\DUr}RTy>%frq'i'SqQԬ!yW>&Kd(mY UI(nZ7M(9sCR`?{VEm̆ce($ .C#rfho3ry̎ifY䀹TAd`]j Wݩ^!(&Oګ$`8,~U…Ɉs 6Tgaֆh;:C7ɵFo3shQw| 1>ܟh#:Fk܀*8IIOC\*A\(Jy[>P[pZN 8In}a*y]*nUiC)U{?I"+.3=it12x& Fi;O#WI+ūl d}-Dpй> }U8[] B'")g2As6!?D8VOH6*zsPu!Z&ZB>? GiF`vB("MF^H GQvI8*rufSmz[u;1jn= k֦I$OnelIGǁ3GPʷC'+H|&H`>VvJI9 `s,}"#3 w[_ݐquWv+O\:gXɤ]RT3`zy*u??ǘ?Chx+mkEF<zo`st."C$Y6lJW荙daVOJgjSɕLRCpL⻰1ECFҞ֢U) 1R#;6s]%JHy׌k\/W.]/{_e'5k/ЫsFzb!YBN;@5:h|kJnKE7ϷҸ v۞Mϼ-.0p}FI)=tb"US8=OhѦ^I:q:z#I j=&iUd2>[yu?eLO٘||'Jͨ[mHLr3UkHl=DI廠Ye6G.8rSLTX( 8$e(&;L 2 8nAU7z}l DI*Kn qL,{+)6)0]9AK٧ w]D.x?{>5*Ƕ[^}Qcmn:W AQNK/'Pc IIU^(Yj9ZZQ7c&8dt5 %l)#yoI+ЃTL=i&w ᄂvSxaS]Na\d7ͤpF+d֝ z*1Rx9Ǻc9䝇[$>uһ ֔%9܏}pʼdt\xvI׭ ^`3CJ+D7ƔcȑIfc*dZԇ$(*J* N3t' vuWd>S\!!gPOm R(7I%U՜4K/m.O=PfF7AQ{qIBL}V_q!qe5;-I%;bFr|?UH:}qd8IM)ҟ~ O6 vUqRմXo7ij ]d Q0I!Qi=Ip2joaS -vrT1'x2-5 1dF-G#9>6|q |`c9݊hpsd%v44 -ѕMFI2$ZL,jA\#PQJX8Su^E{JQѲ)ǥ0 u[5*x%c,2cXt#gWn5ŦZH: 2;ZKc䂼&mψXpAbvU5ͥՄ2>x)P~fO)hE6dpHhO܎-umpHʲ)`8ŧLb2!?7+Pwa'rwD~tl5v+^%uyj9ƳQb?5"B[i5kslW1sp"ϣ]*wnymyU3G+[ rJ8XQ}di!݌ߪCъyfkqaFt`z (] *]͠1,WG_I#G[=}8cA48c("#Q Y+<.aCUq\V-TMLIoչoB'#FAI[^85XP>*oJkPvsG39'>glXHcUv`,T6d xjQTed  0%3u -DQyϻC7g;B|`}fP@V-sm?8vp;y$o>UF7/ ޹WMXF162Gj<ݨ6|t(R7Sl\)4J  3{QGrjd @~UU& FΕ.]Vo'sieFidM)#B5p2 9ILHOuٍLy#dP3OO~ژ: ƒ@!(jmgF'ǜPrU7P8ROqxnb/<}8ťޯ"k{`y{\RknpX4=Jl70PI$ V݇&9wCC~,e/n%*7gr8^qme$$~[>=9?EMl:U-`b>0fUc: ?IY̸ *\[ .[7} c멺K:}MQ8|ۚFgo-qV7WRHzP\eRpҡk-0wG_&* %s!JBѮ&`d1nWL֩58x9cm%p@`>rIgKUhLl$q({_d\eiO+tyd.H#N:{ BdSw3>=vvo.ЏoBq#Tn|EskI|;s s8̂:9S`wqm`,? )TQS9QUMpUuDuQSSlm̬DGv?HJn,ESPv0*B?کISM1>|`FIto|k=,~S:I/ХꥻXDvKvoFS)oM>{2B)99 nHpZ99?[iZY̏"4h5. zlMΝl02݈dVLPcR:I7vzc }GzY\2D $yf8^jyrFCsx\'x&X8"P%'ERcۚNdy;3z}(Tj=A۫k{񺅯#2D]y<{wN kGXN(}*K8Ir|5O4s[m"xY?1wfrxϾv3$:VW2]I$t%Z2vsi9 KbVf@XyIG,w(0Mġ<ҕc(KRFW|hcix0Kj05p1ߒ:~|5ȖʨGC sfY_XQ35# m6Ay [86zk2ɩIshB$Tc`;i)d ˜˚رmբl Y47op!=2ԑ$_M|kK ayU9cHC½*t(sg\SQGuRII0J=@Y{m '/O!YvU6ȸH!/W6,[xp8τn_z66OW0Oͭ)>Z-D6>mX@!L>}I\gߚVָn--0lFfKtwZjV&_iNBL|yO8#=^#T˅QfDZT o'k->9q5Z: kn-巡 MUtN(*o,$bhцM'xu扤{s{ ֘P+c`=ޕyoldw,uhv}^|eN֒0iD%A?]w2JFp?B*G+9UVv$dD# uM-|3܉9iM2Ҡ8LyI3]mHР%k sl3xSM :fӯ%8X9,8Ǚ8D@UH++  ~Vp[f ha<@\XUr$ rF(}6mݪ/[KۏQ$+9/OsU>dZZZ5MТP((eB <銜6i4[@#ԥW`Pέsu؞;z* HM 3UNT%O7 wtl'BL/939%-WJ7zYMst860]][#s [lHrYśS۝'O׫T_/SS50WFY:4/ϕfW mMqk RIu8?JRUF5ю˕Gh'Mܿs0hP 1pTW_4ds>H mwW#kqsh@R̼ݶcco" ڥa.,nj4%A%Zq'g#ktXpN2 ی05֖[!H扒4qUE)lea?fjSmA-<{y 攙4ϝ+Ԑ8z ͐O#T!kR#O~jAO e;:ѱ(G0>I_A$y"B8<k^H) muHZzt=<.`L1 ܟp~T'Z}8nD9(^4Gl{حO2x}Ը|DfMb;=[iM:P-@!b}^wzwqX,VHu j51:w{d/+FlQshe BbwZ>Zfn[V",Dm4tb?*x"2P֕Z_W6c$Ö*aNO񟚁tԵ 8"EtRm,H t47Xx1UVrcS¹өR^,s _s SD>wɬ{k1BaheF@m8D}>%Ds6!*A8=x4n&ٔ2SS#A;KVgG+,UY0yXٷ <0=i[i&b c=Բ*Nw `qe\@~Ɯhi8ZiV 7u$!Sx;]wdr:?lZ˨'IʐV "MvIܛ$R,mkin :̌mVlZtF= \2 ʚ"!%JOXF?UHNvl/-->$! vS9$O5[!Oecqґ7{d8#p25n YJIT.xwrc8v$r)>]M[nq\+&xyl5\)RH'FY qmOTWj[c)}zUڏ1J*UvU;;8cӒI'Dǥ:QWOBSb9R]$pz9xʴRb/ b^ &6B0rk*A-23P9(- o%c=sO +*@bhc)dR=|rq@Go#׵7ie[4r:H \z.W:,c1YDNW+s1#IszF܅<O@*mB$M@4:>xtIGOuMKvfovsB/6G-S N';86W1EU.AV#!ڿ6E'EjVidh]'7\nvx9WjAݥG|^_2k*A ҥen#)#ԨU-;l AFџUmQO_/tBʹ.a2\F?\ٚq]&d,Y2 (dLROAiڝ6kU,kqJh>hu5-5ف]ːH&xϷ2`UXD&HOIP7Zfea#!qAHƷXH]?uoO;1 皍&m2^i_{)lsrMmmv#:*UM>&Ef( I܎qOg_I5Ƕw+E`cKx"{Jc1% OQ\Zپl?#'jW;8'Nz{)L26-|w I+l}*qBs#bJG t>/n~!X]ck))4&fǴst܉ #r4csAP2NWkS-/Aq t& YroO(o_oJnKF``Xci1 :y8.0nY~tsSkn.m74jpUe0^[ٚxM_DYhmXPT' )O(JTFqD )] s1cGSCy3![bْ1+@_jl=KK/cM/ku230 Q5{ZFNJ8.:8}#^OԄ|!,6r=/U& -RAe=ͭ,_vNIlPR9)?îFKP\٣,1*7}H&\]01qG@Ci.t7I[塔8E.8`N(;s. Txj<_rPxV]UwxLQ"4lT>ja6qG$ 0\L!̭-H* 85*gڛbt3onc9h9$HwmPOV :,O qeu=ONk=}bHHԲȇ W$=qZO+pѷy3<9҄;}i!Pb gQ`̾Ն+[Au@w/B,667 Gx ~yc稚>\<;14KWivz,#uF b[&zI-\ErF0<+ZʪX0C»(##>GVv?4FYv}BfMтnB@`N֋{9ڭwVjWrKB  83օ$~aoXBw=Fqq[xXۈSʤ.8رػ4.VR2meIj(acBa#.9\RcI* -~Hgcp̲nuFN<;y(9.Z6B7KOӵ].n#^$NwnޙlmPXg^T5˓znK+Vy!xzݐOYZ휲6Cv|${#4=Mj? ;ٮ 0CHYv{\iȿ qM;xs!{=n(CcRAQ_ZGҎ4]ܷ{s/9M7fS2ʓ@ts5O4w2&Ug_*Q*BSeeKW!y hpEngop~ff 7v?k0nCFf Qߐ̃f<};u.) HBV7EA|E!=SPv'#\S*HQ5=ORvDI(L)ۓjFբo N 21VT:1IyEךhL*IF IFJN)1e]&v@5" ZV@@dp9-yT41ZPHsyg54"ݣp2A*oj.J&ۘHIy2FrWEΙ%܏w=qC)aŏFXԮw2l`p*Uor%$7Tl?)WzdFA [ {L%օbtfx-˔*Ў}ApY%$BO^GCO/#xǁWYۉ̧,DX SP״:C۸q .%QYh-)ij~:ж5˔CR{"EUiן =&ӵ(dRcp确.H ǧbXeQ$r. =OJ˝XW@82&DX &+Y&&C1뚸jq UR@'.$;mE$qQmtCb FC021Yc|7E@HΘObbPn~?XXXĮZǗE9Ş]Ӳ7tJcbxF0nfzS kCtc?jRdOCtA3Uʲ(˼r 좠oEZ[(.T d_/RG: #9XӳZGP9%uKW7[ԒO5<ҩpӈ[NB{1\+*+Ij {$=6d9ҟ2WmE2W;ʘQ+5Y pzW)p+LZYWZƠi-\t* 9Fm1 b)(U,GR|Z\}^>>8` >i?fL8أnPr͂<8Z4*8F_MƣYܷ ۴q~@۰v[_Ŧgif)8b Atm$R[~к!qxu9hCW,JS+ˎ kzv5{ءVYFY o' ։i y1KȳM\V# \uMVLK 2^7]]HmoXWҘB脆BPY{^^]f‰lF( x{Is<`"n!g+]+ܨ2Yj}1 ҴӪy;@:ꭝ8vDSrn2dִi>6"~G-^M9myo`XN,@ӼBAj$s<[^լ-Yi"T˳q'$qR4׋L*$'ފ&oٚ9db2dcdH#kTWi[lIA! aRʫ/,`fm!Sx5WV[%62M^V@HX0( REνu%,*>UGZw`gЭrby8~RR5msM]$XK%"s*~noIoI?UhqqۏSÌ/cyQe }b\שkngR.ebmpBƠ}Y*IRţF܃=@=RUSZi-m2Hni2{N0|DANvn@~ux|{B˜`y @GCw*Ele$ac$ϥFr! iݜbs3Ԙt,L`XG^/>9Cόc9qvr@W?fYأ롺Eo6yȭW~TBNF) m,pǹVU+NoLRvf?ط Piz9}df'*>gnDxtaNnJ 7pI'bn?a8la9-1PVd裷GTxJI vArDRS>1c.*[H?68Tʿi A;&2;aq-/IDOq;. Pff>{T(T-:3Vqnʍ/iqoi4D>ꨒvUo̠/ճ~RmL@ b6Vd61o1N2A>t B#UٲJؑ*?]CMuq'  eN *YȲ9亷fyR1.ʽ:5Io88*yP& |J,tvĻs%G{7\lDn R8$UzwS(Q6B@⃎\>Q$/#6T߻3Ԏx3[7A9 jBB,;Gu HD6KuCyvʖ,rut 4$:ѽFO “m#Y8 aoc%'NX}ڏvZ3ێð`GL)Azq؉m|fFj1 Ц]* F&cbO9C3yUߊUtj02ŻJ `Gc?]=uf;D'wu]6;y A1 '(`sYHȦM0akvPgSI$?z8`Ճ cIk'ˏsu5)ژc D37gwTIR\r#qu$| WE)VhAЁUIs1\Z`'*p 'ɨѾyQPCpvU&hyV5BYemOQ+;O666IYW bzWGcl;G,71OktF +sTW66}UnWX2F׍QDݚMisjSLXl\Ю&y@b“1is*ӳ^CÙ,K@@Gsci ;%PQ+ Y7Nag ѷ@E&5 neAh[Dr۔Ź1C6Ӿ~F\B3ҵ6XU.y??5zmps y;YΜO/è2c֫>q++:\L $npOΕ/{ç_V?8pr-} m˞vIh3탊y'lh<Dwh(PE\*x&զd+eaDA#ïu;˘`fJþY0;A''9е9ǧMhm]x0^rPi.7b `#x'@odb]Q%"X3OlXi[$( 2O n IdZـRgnrI\/h4dxW̑TzXW8^|QB 8}kº[~j.:$$e@{yɪ\1wͷpRz`㒖GV1vcUb.rp1 } "E@h]X,Anw6~0.0* H@c1ZLN5-\U'l84)=d2zH7fJ.K'eٖ^Pxm#z+LjIUlwx%N@ qmR`  3"wմ؆ q2}M~@?q> >8~1R0ۜ\- @yu)OVoSG|AIX~`M<}~jnSoMb*>mJ)s(t`mUjiNW_"$u 7篗KO9 Wju pG<AGn5{ySyFg2"@l·PƵ\',ݻ51M;\-mr7Ʌ|$?d6y%h4KFd_9+֭te-iWm ې#ʩisD  xǕ<}gA 3G2+ID7) u9Oh6ec!o@ߏFVO*og>2ݼ?8&4pC MmpnD80~ 5ޢ[{@# lxNֱBkm{m;#Иk*HW{]+גk:M З,T0j >U+\[\:"IzJI%Q,py H-E$iP swv &Ifc#ybBui4<&ԣ|w%p,@P=I50w ZPH vgg_V6 H]Y{NE?LcmZ6su$mPz1>TY꽭$0Yp QJM eZ_'c4vFd9Chi4H6ɫiQ_:8D;OGjߒ]K Y9FjΔ ʫ/yqL0V /8orv{D{KYS#PܳZ$ d(-1 A1Yi.I>>g.{ ffi)3Hn!&A8w Ág\W1As*6ACk^vn0[ڬ1=юz@HTzFH>k c<63Ӧ <|\fr+{,veLy ӈPIvS; φ= )D / g&F )NͅFpRs/)X,,<$ pzV Fݙ'|3;6&3ڬeo ƒuvwOVza.0r|mOx=@\\E2x~N $\XAwi}ƥ,wS1E$v ~ =>zo=5=>{T=۱d*oE"YF P=0S1u\ rxc, I݂s׭r&K{/]`I8穩M)"FTPEBվ?x-}^;M:V"f ׯ41A8UB-/5]z9vʱƪ2Xx9VL&gEpP9qpO:Eo>d}҈S(K!|\Q օgO]c2D8S| Idt,Qq! >`N9ǾtQe@<'iӓEV6};ʠSh+D6@0՝*ˋkp31ϩjҢ/J5y 2H,6mgGdoW}3̠Ln}B6ZHHu[ Y[Q7"$iMekaDroh\3cH1Ih~ͣkm =M\*=kt$3hu213"'(V* VRH>cE3KKf ̥`7 'צUӯx> !ݶE̐@ԍFBP[B~!mni&*7*m3㑎]glk^an` 9I OJv{zŵԐaéF>@IU+]6QC1#8ԔyMf:d`Ut>\HR o DbA"wҽ>+ؽU.*%k7>H XGLʼ편k 8<(Z(ؿ^6`#!/T5 Ɛ33+O[1*H#MӦ2Ŵx(G )+V ,p;$ r㌓PeHoUȍHDa0JP2H"v l_^j q+w#?_*j4tKiM4?Finp1nR<>Av7K0$t'#knq"m2|K Lk{.)c,~ʬ#'FGqPPgfى4^Kh*T[7%{#~KBmmq,ތ@9 Z ɉ9**:At˴aR,ג޶; <̛BpiAR5* m``wV;x/c+ÚjKRCT)KR7׷)_оQV~q^ֶ̌ XJz POCV? ErCΙ7I>\ 2̼OƓzWVEȩD+ߦ]NIA h8- {f_]v94wi{Jh'ba{`jg#%Kk(|BC'Ƴ>$LZYq #k)gd%Y̩GRz׍>! ׫ඈ])9 uޱ]a6q,lߏG1(СWϺ7vchgvWGA/) vsBYq,̣8 Ut-~۴WkknO,.%8=hfE;wIAq#l606UVWm)$0pJh#>UI,P]Q}X]`v7MebЖ=mzbW$cgx]o$7 r-'x}-{EAȗI-k;$n0I >F\2:M".㪞SL?H>[?UL)@e"Iʁ$F+-kUi]Q[x5 EE =K?\dzVn$}TI?e4kh1HrzTTT(j Vgy'4sJ[cRI}~Vc%.S2dp&lnDR"7ASOJ)A rG^|ڝN_N taHUcoD]?G@uAiPi1Nh+p rH :\#}:4IXvG>9q1UL.IMQR>UҸ9%8d$g9y&|f|_[0O.i繐؞FKq|HB"?Îo&b{qa@8%INC1i8~QX)V$ s9d'>ȧcrVI.-qz@Hq OQ⃓.c ˜1©ِs)Pv ӗ:c;q]Q,G :`Q89`ՄVvP0* !˝1mam\I 7w&{`@0dܷv 3g/NrO=a/ hEy#E,>@SRTj;XmЖM޹wf0$/C1(]I%*6~%v$:2+[`BHc\\ O r ",L@@Jv3ԜR: My/S| 9Tc$2YR$XNݞ @>=Jv*c/n#Ufb @5 Hcڭn^ ]EU$YbX'V=@t6?K,hAе\B"i$.9Rf~tˍeP͝\ ^"}d'--&0<n{A$r 33Si c|ޛWo*>pAoUmn̴8{Y 5B&3Jjѯ-.[2}MvRQxe;VTMxouP5ĂWezu@]Lw9%qR{ڭwU'b>۳< w$o"kVKt.Xʓ2m>C/G仂Q^;f,ʤc9⊙"o[*s{+E*a9ҩK.e7s MVT9(QO^c(p)QNhVJBXvMZɎ7Grd$nn c<ϥ$=̬L1;(h`NXԦ!Wnr~Yӌ}uHKbppwqU$G|O%{]S/as\Ypiw"q ѿ=rڿ=w2}Σ,xqWњxt8k=J=*ZiF^n"'dQ7H"a;@,20s*~"޺Um^+qkq+ `m+t8p,4.bvRġGfbw`uOFX݆Ĥf'c1.r5Vc6q$]ns\v;!27 T28枤{!%i$>? g]%N֚UQ6.|8.LaLoW>eĪ&`<ʗr.i/nm՛K sPvW}i".p:“#Q3"HYM$SԪ^? l[6:"Xsu\ 8s79nNO> *60[-ʒ?,FEgv<[W c̒j2#9#@>sr]^Mc۠%7MNjϕEGb$,NOo:(n/s3^8bXSirY1= Ko[!x^Zii]`1s][x#2G"66p<4>w*B$ |EӨ#Obs! p;dJt5Μ \>ڟ,V|4]i`Oe5^%ĘFֈa,>;xϴ*KbT>s]PqxƩ]h yqiABs]d%%$5Kp.vmP~mEqm<9p;7941ݾpRUcclӆ(5 9iUQ]ڪd~;xESɪxBS?Ius/ˑ8@w3mcrǘmN)pc7 8M o&J㎹ z2=*u7<% Ui}jxcprbj M3 E*y ⎬ҡX=06ǰ !cc/%IvHc\zQ^gZFDB<cdc'm*'[띠m? 0>ѻM뽬i\Ď:Nl!cF=7}Rhi7/38;-ѵhqa,Ҿg|o㵬 i.|M%F9X@}Bk0R6S>*Ba6vI(g.IʙwnΦO)=YjnowZN]uu*n̬y}tTTP2Ih Ic8<8   a1ѫprAКxsՍ֙i,*Źx6JtEPěʢE6 .mڻAWA|⏰"0C_XIǘ5c`$v}#mp3xǝqNpb+ƭБdqVk@Up`ezWKUI|]vrdb2Q;ӈUN7 yԭ)qFØ[y S)GS4345(>1Acp>C(Qm\xt`pUڬr=lmG");4v'*v{GEcHഁ;{H01m?]3 |LL]R.Dq4TY6juY @*%VԴJHT<=k W I -d J0&1F?SA(=x&4R;*OHU{lmp%؍WyqA (2~lA<=ʇHj1;6hk3^jUy\cd5qdx dWe$ݒ]s fUܢADgafMI}L{"=!J~L:L y1?"ԣR .uWDG«P\ *+9Zl\]O%iX ZR-[ HXٔ1,#%o]l?q4ю|ctsym#(]zZ)zz fuR#of_WX?W%niOK_ ׬-e!$qݞVy A8e,ׁ^Yd\d3ȧCMK3#<8=~~8#x :uCif';1<̠n`W 1A?P OS0S'hdȂOۚ"ފmџNGc*=B@p<Qu{n.>UąLe"u8.]Ul@c=r~V5 mlUjҠoEYAz]e H|2{/UORa}AazEC99L iftg;TrraӮk3:>~UsbInM8DyQaG|@ɤ: Wy+G<A"RJM9Ww{j=RiqR5σd@4LI>ʑcg< dgmB?)mANaFE^ L 5=8BD^ !ess^UwqZBdyiqo)joU\ &R|#N=K[4R!e?-RS)-pWvl8 z_?^vo:X1me#`k2*#* PAZAiY1H9m9|ԑ}x4pe_nP@C_tѦeHo&ܒ#E;w| /{P8v~)aH‹md#NEbZ*^3P>(_Ke7")M*-;Q.E=ᙝB*]^sL,vsDr' hTlI9;țiD|xDjU~ڏ.JNwϞcZ6}oCxֈ$ḹ^ =R_W26sc zyQne,:,p "# lrG*T6[@4T`tYs:+-kP 6!8J1\"*'?1SQwuvG泥i?m*.$Su׆VyHZ˵kPO 9Y82U:>vtɮGnqm P9U @P66^Lp͒vI"I]TW;O9=F| ]"f9sLiz<.QZi4;|Gv8c *z\PQp<$Xǻ&TNDք{_5ՉHH8,}8Mu`x;!=|<799 - %IqS"U:<18#gi<[B(y SAY&0FG֧,j]NG5 py!r[׭:%: *[-ơ0ʋc8V"C%8(n露&dn=5-UFXxcPg@5(MdmU+xlg0lErumPȈ<`GR P6y \)BI`} 0js}s4w1MXt_m4F nJQc"cvG\{26bDjұ,2Án[H]H)!W Y_[<1ܹ A X12I9ޘ"8e6$(7:1OJ+qxZ23K-Gc'yNcm4O0Լ~XQB ;e/ e>~s,.y V|;OdYL20P-msLKUh!ۆ#+EkxLCj Lmͦ"Ԉ绚=OS6FWou pSY0ƌpj4MGc 4NRʹW$s# ߏk4wi+?qnPYqSx%Ē *+$M7DCJ3k0``u@A Ys9gNۆqm$W# >NطI^`9Y*nT2$Km9'VP^t<.4ClPx .ed{F犮@tjUk"4^Y]|u!PB ڶ(YI@ř |zUL*2VW j%d E:uk^K"8)bBAU&!u(.Qټ+Ե N=xZW 7ִ$DU'Uο5a: *u- Gekoipڣ語ijip!9RqʜǭHyHYoɀ9jQ\m  sNq2 0,;H ;/C9(DcNʪo?mEme(!!TQ t>m`yֽ(hm.3ASMhֈ.Ii3gF=2`.*}k/zD$ۓnzVo{kVCvE%xYߓsn<\PL&}c-71^ ##FѸLms Ti)R+hxQ]O{-lXWmJ'B=C6Ўu]7rЊ]OQҢ̀qK7:|c ߪ_ *E{!|BhphZ\a95=*]-O11tڮ2GZW;-Ldyy4qzqQ,*͜#i p`p+DA`NiyJEm>uapԂi,T  ^ZKdGzծ y03=qMj-Ӥ*H 13ވFs(\9 : 6HܧJ{~Q\VN$U<Z¤8*^wx\d#+r>ƊZvak) TI41f"`"[g=Ǭ^ZhSv[XXRyaAkܿ0 ۘ,uNpЕM%âFs^vݤcn@=I>T>>>D{J@?m jmǦ|TLXxI6n ո̑ȂUMptFL;QRąB pSPee^j1mH!#q{?*"~ls|㤎%'k<@iRwCooHd)O:]I%d"VfV`͈̙JY(+v`Rw2C.;I`)FK2]w`;[>bdyZY. pu A^2rFrMEN-DKw4~Mv QCy`R" u㨮PJmLA$׊Ҵ H( )h$'YEq `g#6W$r2(mbGHvhTI!ar/diYJƱXw|T2v.9,MrX*V\7~ʒx\}"}SEGb@I'&:0Y ^ 7DQzRKA b @TScm'<|_ٴ[/O"+۫|zw9FR^Ph6wK2N3늨DraLP'. (qBf^W.^ZtE;,]bxG0.S]6ZtZu!J\#+ڌ*o\*FHS}5b;0e?QꝭҴQlMJIVPvnu<1SjMJkftգbqNjU"cB" 0 ೻刵؁?]GmCLڸ{+w"w3+Eq b0m>Ha ybU\`i F cu?J[iŶ< XV8U"xI8byOEH☈'Iц;1Rk Gt.{yIZ)z)ߎ )"'-{M\A1@>jnB>W .6<`WZCMrύJeK|(fY9CtiUrxUޜ:;s֊)_*dsn.AvR t`t4#Π! w5kV༌rE r\F(&@ Jz'4/ڄ1jUQ}++-@Hߝ|Ŷ]ƙ<\Or1υO>n{IUSIo*Cr ,a8ԣu{eCb'':#)Z+{[B ~Sι4KK/S Id|έKikelM!A#T0IkNN&ik2U6-+2?rEY_ZĶ(HJE|*g5}mi0IB9(w9P8zQp#ZwKIh $(RQ$ߢ~F~zt(4 ~SoROZ˴}Q_ 1F]Z.e?XQ.kI#^@iGg$Sf>H͓wyXS<,(]`(ێ]vU;iT"2G |T)T(\3r,`|pѓIK*AۣFO2v. h9"l`9 *8#Z2A \ !\ rG$Uh-UfO5t5#8=+ZTAea_?_QFMAoI6lF@@|\gRv@0T73\LG ) c8ϧ T*fiYTNG,C[bpx8#5vTKv3qˊl`)Q@ʰ,q+lǵU]OLe$ hlTݼ34}ݘh)wE-1J'28myǡLQ 6/hTl#Tl pvZR+ŕχ P͘.^ zn$. =z]U,BNT,쟼rUOVm:Xf\ >o45 *YCׯ>9/^Z[mςpY *w/ j-.KK{Ȥdmdl}x(j1I>CطOl2${XͩK$:lIa-2 hBq8{h#KhGJPt,N}n2KI01MOѴEMJN(]L`N0Zwh:<-.w"wd2CFHf F2 ㊠fK}P`%,ƥ:sZu Ky?歯cL]B#meRwMe4g8ЏbGM*d Z BϴJ1yz[ mKKn(P窅N1КlvVJ]hдE!1xX9^|cNnjzB:y/,@+ 8I%g wr&XuRx4WfVv.>=4,2ȇT}PIOmp<ȡ}F3Ϻ]Lw檮fR'"63럢dTH''pTd=0GGZ3H^ˋ~m´KH#j'WS>twO2HJhw9.1p͌ bv n&B2 6ӀFNQ:I lPʴ{ u#U7.F?-{Gf`,'UH-n*A ܸbֺO 7)B9huixPDH(TzOrVU49>T[e9'5_[1`9gْ(bVe23.K1[U@aA$e-8A= BPlǭH>ycS'I< Ԥ%߽c J\q` <ȧ'F9ϯ}P=Ƭ]2K;m0b0Gs}5[#3ǕWc&9s[2R2BS#̃.@6gojJAd0[8Nt/fui߾'4#i FΩ ]TIx&KIH$C\a6&p:\̖y7$ɢvμI" q =w&)hX?$iElds5ZV5>AGZ>+1pFƠjn#ʲZD$@37cma>,H0 nrΩo`u l~R=KNM}@F}1&%/_Ě̲LIHIV SgYKi`{YN~?'6<<ϾQGi߅fʙTț9ZڍFTүm3uq,8LJ=+u#j6t V;bx!i:M2; Bkk;nU+'zC~'ӣbfx 7~~j-n!Z4v1F 9H`zU ˁrGFP+Rm;{?)t*ӻH~E #R`?$n&~ ih]#Fcҳ51{֞漾VVXĐF#0zc7fHDCoDHqQ QS:juKV "M )Pok$K F"x8Wf ؒXۤ~xMj6G1+'wW%e?~ 2XG?*kNI UU+fV3!F*Z!eq_%#ni|NqI ,1mGx\qi) ҹt/8H%߹`s- g,)܀I8[]󴪍Sʋowkuted^IۑqhCOmtEz?$t =s\TiRgQ“rFs*LXq@mo lr|W'ҬFcEpxtOC c1+':&hKsc ,̌Һgf{DbA )5芉/5F 2璥x8yF5]yx즒H=gV*sXQu`g13nJ#U/ VW&~-^?(>SDrʺk[4q$X~Y+ BtzG Kx"c'ql1Yw*x-ai9J'Z't*[8Bx(zp+,2 q]i׷+-ppKʠF0>ʢfK{e$f+D`)j.rǞ#Ա >ڏ[v];G$U29]N L##,>md)oeoWU$O5>KVYvcoF)*X&hA*Ѹ`W) w,,)̲<ҏ/^ط#baYsG=DiCsF"l{3ȧ1橚^u^%30 ir88A! @$1)4b(QRwzg9=3Z 6 k> P@X-;;]Yix-.QX18FTYYTcpac*kH㼜 ,xmؐfN3.0&HewF=vwEc -o8A1fܓ!(wZ/e:}ҷ*mަܑX9Ibcr:uINEki:AjHBc/OO$gjWP&2d?UUXd 㵽 ]Yr5S7`lOcSJAq[mZ4x*Rd9 !u!ۇ>ϲ}ݲFC"warT&)15{~͵egF,͝ sZV}z]b*3I5Ԙq391b݌H8*A9SQ12v:F鳻a1zc?,:u֪vJeciajpUZ]#G"K~ݞ Čw;#m$_%=BYu.g9&E0V3ᶔl 9hzUsP֧QV1M`LVELU,GEA_u}I vHóK! DG0)B-a# ek ȨFʓ.\Cd$6RTI):Z;u\hגCkr-2m` $#ҳہ,#=:k'1u~3B(9$0|#q#FRM1OoI2A~"vbT6z G]ޭo@,NQ:<) 9޼ǼS9ctM+X~Z[ZUWW dV!c.ҧi\)KqDI3cpAǐTp\2VXYȲdCn %z f mk1 ! ce$l#+OIc[9XiE!!`FZg7X 76x8ǟ;7IO,*c݃8?]vf^i5ͭmYUٸ3e]1뚩Y!yVv·0F3 t)ktVCJ1p+4qkqK*r9_ꪸ o NjmåČĀ3qrheW7v?=0Z(,ffpC}B`p>~yzH}BmJqJ0DǶ\jH%'q~xɘ\g5&4hIJ[9!(\YT@] 2Iv%$<@Dz^'OZdMgM^xD3*wcNvFM ],4EHSޏ*ЌvI:87VXG+cΐ-ꔌ˚@&4oBH5),|XIrsInkjO\kʘRi<+ąD]F.#=vTw㵇R#LfT}vFQ<[+m*nu@2r:k-T"  Z'}G{+,BI#9t8\{]r0]ɞk];bpH= [w[`4%ӨO8*V<{ъD&mOVFB#dQ*Ǖkqw9%GfۂL:do/KZ`cqeՆ@a~~>~)n`iTEm / -|e|W"X9K( tDf掬d=TMW]93xCc#IZֵYҌDH|8,zJivHIH|Yª3V 3@ƪ +M;ED9%I>Y ZX^.\֮-!)Ʈ!nATA҈"B6ОF~WY\.r |qT6o1+Ow&'r:5Z]]p!l51u32[(6*2}fU%Ŭ;f^O3@.[۴<ٔNx gWiV!s#+z`m'ץiYL9kgFCZC@ڠNqAѬN"`\#dnNH%$iI*$cht# Mrݟd$UXsiԨY͍emƺoO)OZXw{>V{؉?CkH. ;U 2O;|Oku, 3*!SY[jY0k.@F^5el\NaPƯ^*f #)KmGRGLtvN=*y&O IϺ,h'sFvdjrvO's~Zt"V727臅ǾY+Ԫ^ڄ68L,-t :¸~=H=2Vn"5p,MRĪ=T2r=)&^Ӥ='>1Y2~PysR-.} |S R7$|Eo 4 I+i4=n5q>2G9U\{z{hNbѴÜ+1 ֢~;(IyeDcxU< tKx!6£Dc\ yԳ3w;5|lA@'P]K ](ZHĈd Ms(÷P1kiq@8A5?"Lg|@Uk63"pjXc羮;s4A#emPn͠8t n|1> ̆GyU#n6@U[Ok*;B!8ϟZMBFTW7yu+Ssm^hti1#0Ǐg a?x>Vzb[+\]ou13Ƭs;zzS [(i;h?D~@ o|o$cH,I`m柛Z>/5ˍRpAJzG6fim7H{m&+hW6AXzf;%A4/ZIdC ,">^ Az4:aϻ1F}lCaC['ӷoҭ\_ '%vS,r96<}U:P'jkؕݻѷ8Œy<3 a//gkN;z+\Tbsk,m%!p|8P1P)$Dž4;9nRF'p:|W~qF}Ur -dWbѸI֚"v\ZvF2Ƥ`J =IWH`s]eF;o O@z=k[,rEwñ,Qwn_ xw_cmg s#9}@}qEQ-4˩e7RCׅ;)LL\dž^mis[Ƣk{YCj#nMSb[pnD)..rwҭ5Miʵu;҇Y F}Ҧ HɭlyYimn`)jo,2cX2ĆvR(R-o Xc/]v>6{4gw)8+4 `0^B]CsF"PHV|,'V3mz Sdh SX 5g$kUs$n$p,-nJ66]2塒6u__ϖON ȗD\[K$]0X+`d.kKxɤZ/#7 ,>n9EYi}[rv4KwO 巶 9dp2<ڜfoGyu;\-Vv0p@hS/ NaJtDx9QIJ0e*0E'`α, Q>UK :^(q3*v|xϹمRy2]`@οq 6@KpH9?JL;dI  znHs2:vtGV]겺_;9oզL+/8|m8PH^~PhaFYU3"_ sUw1 $IUOkr!U֑S\4]c]z__3#v#pV};/*<+ FTuh؉T`,_y'v3jӻ|\ @,BlrTsDl-1Y1j\I&gpDpLaYf!fRe*OL{ywa(\;U#Жu]iZ}ޫr<%T;+rmq(D/p`C"pVEcP\ɨid,E Q 'h%'5I1/ W[#+&œGNK#L}kn>>8TꟄVF[qx-FfvW5!8+jIIeݗp;F2ۇTaogxAx`M6o\4KmCu>+m[w[HYvwIw1E},psEALq Mǯ.ퟠS)CUZ2SEsZyK:€za4+9xLI%'"3^SgoaVؙ=FLӣ?k DihRI _ (dXS28j kVk!qIWc[,M@\q 4ﬖm3t@.ato+^ly2 * c?'gƚ\EkospUP 73۫=BxDHeWTaִbm$eJu]q&NX*h7'FtMJkU>3Sx]2o4{A}®FH8>EXw*r *[|7̳6z9Cvp! ֊A\ n*@6̨XSCMdY38cMO;nRhF,ý mrզUMV8F3j⛤43&9]S 0 *X$eAXv}nŀDPc}hUk~9${EMi{.1 ;՗8|@9`3ZQf)MV{.bHO@{r8' 怵X~H1 BA9>r9\= ['s+%{%ZԨ2 č9de]鶭S~C tg6gC31Pt!BIO8#V{Y5[-}xƐ,yU:aӾ3MX@kUQt[ѱC Zacz0Ӫ–Y7S"yeVH!6ozӛXwqx1 JrN>uiT wf#wy#ETjމ+A{xJy;|#iCJMoR[֢)8nVؾi= e|߷!o\Bj;k$Z~g= 3G c p U~)eFhQB d^sZ^ 5p"<<؅;Dg`'r7Bf5k;rb̹y[v!bp$UQu8."u&)G!p"h7^js(!mwE<W>>G_uc`ڷ U#^0$Oeg:{j S t 1C n }9ae~*R.ۉ2`'K'*<^xHKW,ۉ8}e gHH(UY$)AجFOCZਇ"F_hbTB Y?GAl}d,@SRQ4/Nr3L48S'I;Ue #N~E}#T]$VK[n[q"ýaf`qUrkb~ Z'ܮpקJԮ5MIL>V{pC[$ Sm5Hn-")"3Kca p y;u sYH&YM"=%ypY c׃MtP&놶MGݱTtulx6V)a[.O|crB,v#dx; əPJ]6&tqr rI8E8qSiK['x!eTO[+OѣU%ʭdqU9t3'Yc"6e TU竞Ac=zgVvuʛ76Zb "3K6ZAQg:>S]&aɔva1c*QY4xw+'W*1YVOp^$"8o#Hn#|+PFN*:yGT,pLk{Z)N]tf1EkgY$`DBU(8`9vkk%K ՜RA]˪nUbsXjG~5w@pǏ.*!rKwY(mk>L TF[ٗx#Auw~ݑW$XYHn tذ1Yn$rH*($+( ^OrG ZFSpٗ g9ߎuʗW=,J&HAd)<@t'"{oڎjw$Ь,!B[8靣.(4˫+Fq!qSZkZh.g+ RdEڛ՘NK7[H`Am *FP|(\[=[^IxwRI,je2G&sO ]#*F]>`*/h4xk(Zmsm'|*ᲁi\N\mOMkS]s;ApT-͔NGeSNK} !+Kiwڂ_(c9Cp@sjHARaHARrT+|Od+g&n *p'XO+vW~"s-aŢ-9g"b$TbN.tx)Vf\GI5}ey#Go: qГA#[Ե"^̝0VDc#U<HDdĤu(lZ*8EIΜi4;c0-9BdeP~Iiiy7͙ٚc'%r}NOۚ@0<#wsn~˞Kza1cjt=.%pQT` 5/Z2f, zEDDF 566&gITN,툷^@qT.@6pF|8wh۵c>gҞDBJ yv&7IďB[03Hu$;395/^/.&cp|+8o>M5u`eIo!`n"ͷ09P6&  Ú|=SzuِFUVbOAWATx {wTd9%yPt>VwRhr'ĤNG:]Ir;1llaIې$.l Ta y)6*E6ZpeG?STjtk4Gas?⌘E%Đ, %$, GTPsJ9R--2#Qlw%nbxO<~6cb7eH-ÎIIxsYٽQgw )<?3-A}ad[KFu-w&YGE`֢11^-?L`цEqn 8#'+px橵 m)FϾg:>[)c>Dd\5 u+RYȖFQR ޠ zOEnmS#|!a:g\-^; x`%1EE=U~UFɁTYG痢lK^i'W_ʛϰUPd>FZI9kz> ~Ni ̛dBTb!F0E?g5VB7fDͭ",sN2YK :ie{y%% r*k B2F#1.T <`RM:83j&-Ď0Im͝*IɵV fǵIVwyIi <$6+n1\ l\/ƣy k 綳}!E[Iz5*ݬڬȲMLЅl 3GT{3D=,jF(&g[x7"1r9>TN&cc>njƎ9.Sdbd Vrf]s!$? MD%Zwfm2]`m۴I^O7gO> MAw̮!7Ay^Z(n#l-R+M,Ҳ|,6apI#ʇK͍ݛ| ,K,XQS39F5-݄$}y,K1oi /pѰ{  p[i SKd-- VVgar>~; 'EQE #7NAFާ'')e݈[Inq9foFaoc\w&&u,9 ;Ü5Eq}4k>*@ffv仱t?Q z- -+-!@W s@޵aL6H =S0jZNB.y ]>!n2G^hrmWBM{ҕv۝̣@jZڛt/7P3`d{j@+8$t}s"(TvnE\ &˴VR[_|#ֳ` mIp2y5[w<Hđ|$O9VǻOZ}ḪNrR"u*KE-}>m>Xƅ{YXjm{2åJIp⋂F8$)/#r7P%g諭OCפּ0‹(TA< ӜY{pi-ĘAZxRTI*}49ejW#n*̊5a{8v76BܣOkv6E$x+V:LJS&/TE`)3v;[oX!][* %ͦi4w8 @qphV۷pi'Puv/ʨj@>JdTڏ4堈 1-ikC  wg|dwJ{4rcڅ'%@ec:ϭ]bcN< vഒi{ipo H{AhVSS$9Чzx.'NℒU'M]>_ioya+C 2FJ)T3\{}9\Vs۠Ap]C7Βd@Z!^P6[psTv~O}khћ 2'մ)Sqx9zAu*f1QlTşd!ĘŹr[I)UŠ6D:3;K~6,nղzFFI۽X,Q)'U[V}^]DM&scc ȓZ qhI<ڤ>}E@GPryG_<2İPH-wdT+9{K9HPuIfV*+<LA20?Vhɀo5 g7\2٘-x A|c~:I{?HfNOStgXt@>>tJɩj,s%+5PUc@BTdFCz _WW9.ZFes3d]C}'y#CRiIsm4 @֣icU,3"<`3wr)`SU66->s2cfCo"FXv 0Ψ%b2Ts7fn^I:eâ}5}`t;+vXg#(6I;bj"/9RI0e${,$gʃ4vQԠ[($ivS8Q/mj]/eD7]&wa6p3X7Ge)8[ RMs1ᙔKhfe`ä*ӌqsXLmk'!vvHyr5X[uv` ?*Vڥ5E$62e8O_*:PI%:gŏ=*^[܏X+3<RF[{؈av8ϞW) wm\Dzb+^QIi',P 0O 5cTDjEze\I88qUݡȏ$sIҝa+R~P2CdXzSWvc|q݌`DkO*ʣ}z@Q$G^GH,%#@q8FImˣheMVsR$fzs]V v{gWU1*T/ԝ-wI do[n cpA7W "x}Ȳjzm =\ąw+$sOCWKkX=C*qg+9cr%ߖPݵx uUu%t^86E LX.x[4:TVlf2r7yHXk{&uؐh8#85jvbȥa]BR! d6<jB.ue}AdY]ImsАFHX]f3f'BBθ%U79ȨW/$WGPgab."!H1mn.NV%Xԗ95+{5.6Љ;Q"$ i3(6 Tas߼pj+ eT:ʪu[X ,m :W |9|ŏ/*bNR4 a1pȡXHc v*e \,7@.U?7i<%7n9&cnCdᇚ}ͅūܤ(\f# æN)$ _[[Eeq2TF9S<СX= ;&kW0fqJ:=:#,2[ý+.@b~FzKye{{Ȥt$;~ jVmHLx =@t(֓mmL.~p%:izjp\y0衲qUfz٦ 2łpdWZķomv$fR8\@т+6s΋jl9$!bPJ>D8`FjZDͬ۵CO/S 󚽋Xv[xUk9n=QW 򢡑]_h' dKX/+|1 R'U Ϛɢ}iyXG.9:TB~'E9ޕTm\gڐz^RV]Ki% 7UO7[ZY.: Os }3IzLBcSѝ&eQG?5hQ(ܮqps_[)h6Q mi{[Őnш8;7? VjЧMN17 x֍I+Ghdv[AfmNﰄo0qm }7ak $0>y HǠ}5 R8!\Eno(;KKG6vn)ƣ!I J ) Qw.A# cs]n:>ʬn$| u7 n5k[e-q2DR{eG׈pqb+&;}1(V8SQ%Ќ^7K81UOVa=|rT_w/rEqFPj<򿼮o01 0i匸&^;N1]+Q1NGc0,|jA9<y+yd8K]*QV\qu9PYt> ]gpǑPdi,>aRL._nq]*a!aDI?E/w]2H8JIHsaqˎIR ;R:X0{W=)f8}BluUI68$c;\ҕkr01xw@N}&m`RFQ7}ϟJGyWZKԨ_մKHl-R¼ ̤!9qUgmf]JU{K,#9Il,usFxaKƠ0";׃]4>爂4SUDV]2g^$o n;X,0w!½`wq0HpQW[wl#He2 |Nu^Ep[^qj`?7'uHo4/U #/~FUO+k,g6Gݺ*&2 wQ^*L;7hN"|8v"ɕ%8AVjp޵THeV x=zg֨l{7#z F#uB~{6;-4H*[nyaQ o ϳK"xG˺b6] ~q4Lt1 6fJkˑ ݾ\Njb41EMIs9~^\^W/T+rmqQk JmAH}t0iu_#}/EzN+ܜs\$Ԉ4i*M2;D\cFr>-zl;,/q쐜K$c zV/9q\s@Ϸҹr Aȭ[ qIʰl$zqH~杜AR2 ?qAJw}e=X5G"cTC&φemٮ)[m>g-xɸ.vvmm7~05Ggixh>V*I8~*S g3qǎq-};E!ĭm4ЪիYzWVB>2|2}@,"0<\hN*VYN1pSTAi\t]w;>g{K;r}O֝1 'w,3 }0 2ҸI'|5zTS.~lqHy WD ƌ8$8Yc!<:TREޣ dp KX'={ae# P&Is݀}GCVBk2un 4X ܌<:i$6?{W޶T~Hbpyn4Q84Sf7oP1']^ZVE7 HI|d:+]SOޖۤ]4;bA c8έ%.l*nP%Q c$xHk=s)q|T],brHb'-k"vJ7hlEDJ+Cdu5]{>5+U FN 10J3nfeo% {K}='K?GFi)Īt"KhB3 1?$n=kVU6E7+K.#5Cqr᳾>g1*tO4˺Gl6pyتd3D#YL10ysqjͤUccNInf #'H`R#]{P]ʡֹ|LqXܺgxyU,:1grD?naVֿsNDV.N\+ ism`TI擩XFN8ea{-6{<|Îkr})q,lhX ڬ+ZB *;9.3 ysn봉cgOe ѵYtO%>}-Nċl.f2 t,1ZrH2<})֞6inGs];dv[^?{EUJqּ9^ WArCsu0'k$'ˡSqq]H4s'|ǯґħlifqK\W$AP OyGwI3TQ)}0* mϻH09<7;[\nL:HEMҥD@WF#sg "玵]LxbNF G387u;C*#9V{SutIe>OK;m~J01b)B!8Rq#(R9TƝT y'N=3{&x0G;F|%m,.w@QЏg?O Fv #$e"y9$s \<⥍=r;>߶ 6p!x=OW([Ɂ#lH#RvI{o,#p@=s&P$S9brqcv1PHw3& KFr, 3L ;*)vPA] [u+hQAE L*/^L_ G@H _:?R׃/feY_Q`8F0nq 2)Ri=7%m}ȯmu-qdUZLKlgWOpp|ϨktX[ =ogjH#8)遜jeB:s꺧 Xb#hSA^\ihe8#62;,*bQ jRenwec ѐ . NL.q7-\{P)j¯e!NlX*##7W_:uРGa(噘]TקO-$g!u(Uqeک' n}@;%Ĺ'Z*WS>86y%ftV\|&;([( 0s;Qt^^\H" u$NK|&$'=y$9ңKm8m]G߀`XyϞEP*Ϻmijwq%Pܪ붽ȍhC }[i$ZܒYCo;zŒ =*W[x܀iw$1 Kǧ5ҹV_zS]rѳmm'2qyH 0ANą"Fa@Xkٍ~L7 ;m^:MA+]z쮳/0%(T&B͎});I,Vqő#BQ^hV(`Ƹrg5,dqH϶t*:<֓&3;2Қt(pkrz̨$h#+BAǪ\3^f~x';\lhҹrz)n@g{DEpJ ''k*zG>Ip)C,b6|'87dazq>om)ltEL(Lmo AHB1;.pd2GZumt9(Dۈ arhq 0n|8<+|í8sH8G Oyqt.KHXq4A3p39\18993Ǻ bHn:d=ʔG5w *S˓pA. ݟ1NjǐtsF9iA$=)jr3p:* A<5W~FGd$p78ҧ]dRH*TzBIi mu xg TA#cZSxh9P<+ᶌ#DQ+t`+~{)@Vz b9رoHP,sEĤAnIкSlh,F=[ d|L9;c*{V_1zTL9h)3۰ӧ,6;m˝oHv&I1~@5*^FVfgdER HKlX{RC @~N 01oZfneR%@Tۚɨ\ɛj1ͺǭ8;?$n]?r*8 瞇ppG\˒^x*xvibH8ǿ&[`@ÎP2@ oJ/o7`D/'C(}.SU%wpJc}1wvjd*qmQy#Lד7 ݖ' [G͊fkJ,˒9rLjgrݱ"Ǖ9\99RHm%zwn+?MF\K@ Q~uйе=ݞu9ܬ SfNXp SqӯXgH^\<qXn*`sFR" !p;Ϸ-lj* Lm`6q{Fq ?99+} ӡUh؃$#9j,1$ G5\69$-!8fE {+j-sdtۖ{)̍rz|pxyrCpyKk3)ERH>3]uL# œ_g\FE ßA &} ]st)x'A>*Q*]򦝥\1\J: sU,e&P@!AYhc7Hsx\0\TU-V^k.WUkv .< U<:l]jr,G4g|8y+=xWElgc(r~)4[q4~$I#U$t*}zL{;75␠r21D< wqsi Wct hPv"eFH}~ 7ie/% :ʯ%I4k"*&e(=})&{TPT>Td<`uf*/"Jc %w8<|PÂ#ݑJˆ%DS͆,qL\TW-q8*7>䑜Hw>Tm6}0 rkU c $tt.^]'6:2>j 8''8=jk7w}[~8WR}3 8Q] XbGd+99 37 :c9㊮ÁP|CsJyOJ]*tCs\;1 <9N[Q{rs<'xG;@yTBZS"zm||QՁ<Zr9grh oAVPQAx=+%d`epwgqӐƽ8P|$9'p]6TOkeN|JNz L9Au|VJ6 1s +DTPp Boc8>}кSjpȝ&ݤBIY` ` pYIǞ}MqY Q̱F3GN~oZA QT)IG.1H>^<髩XѠH\r*W's<&]s9U듁տMHWrH8}j ; ` 29izTԳ9€g?P,yw,[R]BC yHu9b!>0(#q2ApLe$dcR"n XI\9#ϯJ*@vx)=s}k |smW5HϻQ!A3* i!I` \?Z]*0|r6jqrG4-v03vgL~\NHgqc"*+*P}NkrTK#,wlBe+9*KNM- A*bx[*WԒ3&m&yG ᛁk%xB8PFx猑nY`37Prr}AxYA?+8'=:% lk.['q\xvJ[h'3'*W/; )\pE&YE/ޅ'mH=j}};cP?$dz)yw\~Z-YR1>Ey7QYq֐S]b3Y2z|ys2>l.M-!Ł‡l>313&<I!>qM"I"Gf#qzsDz +VG'-8:xԁK+nb'g?`zneraB1먫v^hHs3$ku!;g<{TZtN hf#+Pyxye"==$VgbIRA9#5&mGWӒIR|i{9#θ*izaX 1,P?U'Vb$ybyudlbF2ly*6UU2&6TGZy"+ 39⤋p$i#=y_p:.!cb1 U2rU>JHe$r0}=>&0F}yT.Un1݁N`Պʪ*l9.G>+x_RUڤA :D|,$+(rM7')|c>_?0WJ`R/Ԁ9zWMxH 829观>O#Lt_;W yuϲJa>q|Pr88rj3V_Q8\_8`q'3S K qq׌B9>\Ձ;#nR ,E8bosQ {^A=8}u bJc>~fOR9\pJr[9 Tz\ cN=Eyx*}1F!c 0H<Җ7cj9 கТ:0  sGiDzYAr:Ԇ /<9B(;Ϧ+rk\9,vX ֦4~h9τgz%,Mޏ@*~WV \rvbuHrq Ǟ[ιrUhArwǕ<6)ʏgLl}tfP9#Q`c€I#)wj w^׷r 3Ԁ +q y>yR. a*Jڄ$3NFzf!\d3n~lTJ TqGB峐2TIR}FUE&< O'M*YFB rqW.pdm'91!`H?]Gvns7cׂx>&A1$22vZ+$υv.I}$32#r8bW;@+3qr|G#>tbτxy uL(Nqݵ|q 3iH …'9$=N<3<9۟ =z`cIb ,}.J2\I_Id`fQgNq]+H2o;JRX,NHE\03+ ю/*L-s2p|欙.Nq{Ry61zWBimi2c8t0*"=8 IX*A遒8EWq+r }{o\c~~ K~:+) n<^̩e>-\SO F,Q+G yuq\3.8Q暚dr}>jp|>oQ;5˒>r@B `*UwYN>W^?2}m4+VNﻝj:=jDǸy zyg1i[?kDBOs.n6^=sV3~wN>[~J w+apH$bRv~'rGYjyOտ+PTPJngue)q;oO즛™]'$>I'ǥ8FH灊tq])&4P2N 4 ON:nOߩ52Xq2FsWCW|wZT:˜} |nti >8ɩ2Y[xqxnG'@~Ի϶I4! '`yκ`<>^O?5ڈ])3'˧>^L?Q*;|S 7:'@?o?n2~PrmG+I~ JqbH qS<^q/u7o}Mt.yqySݻp p)+SURQ%|۞O鱊YWݫt[PS )8W1Iq?O7'5RLj=*w9FC늜} _p %t;8bO@~ډ4ҵp´lAԔ/9??Ekt۬fpq_Rg9byGL8[W>~A5J@##׭5\l#wʨ O7OԏQ5p =,!AVT9w#4;ObMѿV>Q1WJj`K`F>/ExtGState<>/ProcSet[/PDF/ImageC]/XObject<>>>/Subtype/Form>>stream H4 @ Dnn6=+G,Cne!1Ψ d:SqP7G } Ű!C% ~-1gh554;pͭ׉qۿW{I r& cDgb!Z 0- endstream endobj 2194 0 obj <> endobj 2195 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@N endstream endobj 2196 0 obj <> endobj 2197 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1W!P LM,t-s@"\z 9\Ɔz&P>+++ Y) endstream endobj 2198 0 obj <> endobj 2199 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1W!P L ,,Mt-s@B\z 9\Ɔz&P>+++ \ endstream endobj 2200 0 obj <> endobj 2201 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1W!P L-,t-s@"\z 9\Ɔz&P>+++ 5- endstream endobj 2202 0 obj <> endobj 2203 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@[  endstream endobj 2204 0 obj <> endobj 2205 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1146V527Q50U(JJ0f 4 endstream endobj 2206 0 obj <> endobj 2207 0 obj <>/ExtGState<>/XObject<>>>/Subtype/Form>>stream HlA@E_3@5n 0B ¸wb\\!~?ȧq|Dǭ;BoK %U(h3"tݧ' :>[M\e%Œmv 0{$ endstream endobj 2208 0 obj <> endobj 2209 0 obj [0.0 0.0 0.0] endobj 2210 0 obj <> endobj 2211 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;;J |P RQB! "#$%&'()*123456789:ACDEFGHIJSTUVWXYZabcdefghijqrstuvwxyz?Е(uQ3w'EH k@ A\ r5 k@ A\ r5 k@ A\ r5 k@ A\ r5 k@ A\ r5 k@ A\ r5 k@ A\ r5 k@ A\ r5xvuS詋4MѕR囦v:\9•4qCsE/KdRE/KdRE/KdRE/KdRE/KdRE/KdRE/KdRE/KdRE/KdRE/KdRE/KdRE/KdRE/KdRE/KdRE/KdRE/KdR4&N"}fvv7ۮҕ;U\Z;ՃzVw.%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%LMa)J]:uNN"s-:q ӕ, vKqy%&帓γ4ێ {L2 {L2 {L2 {L2 {L2 {L2 {L2 {L2 {L2 {L2 {L2 {L2 {L2 {L2 {L2 {LٚlmNDiqxXyӊwԕ, vK)Vw8nø؎tUr{bxӊwՕ, vK)Vw8nø؎tUr{bxӊw֕ v[)VSXpp ?:3ו vk)VXpp ?:3Е ٬XI\b8DuUgN)ѕ ٬Nv8nø؎tUr{bxӊwҕ v[u`3Dup}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}H}Hvj#mNDKqxؓyӊwӕ'ls6q p6bIBSjv9Ĺwh                                                                 ҤwcsK;SO˷ǻԕR퓦vCZb"ǔЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏЏѣ6) qS;48tՕźNb)RaKB(.Q \D)rR!KB(.Q \D)rR!KB(.Q \D)rR!KB(.Q \D)rR!KB(.Q \D)rR!KB(.Q \D)rR!KB(.Q \D)rR!KB(.Q \D)rRxvyS詫fx֕ endstream endobj 2212 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/24R0B]C#S3=sS #=CCs#\.}\|@.6 P endstream endobj 2213 0 obj <> endobj 2214 0 obj <> endobj 2215 0 obj <> endobj 2216 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@N endstream endobj 2217 0 obj <>/ExtGState<>/XObject<>>>/Subtype/Form>>stream HTMA0 mTtgqFJݴ0,ى+Cjx6Sq~+ hey!qr2Cf$عGҩ_/~  endstream endobj 2218 0 obj <> endobj 2219 0 obj <> endobj 2220 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1437R561S(JJ0@ endstream endobj 2221 0 obj <> endobj 2222 0 obj [0.0 0.0 0.0] endobj 2223 0 obj <> endobj 2224 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;;v $ !1"2AQ #$%&'()*3456789:BCDEFGHIJRSTUVWXYZabcdefghijqrstuvwxyz?ЕѕҕӕԕՕ֕וЕ:yrrk95k95j$rj%S/<%Q&^5/`󨗝Djee,\MMÌ0`LEαˌU0r]*.3;{`#CUҘ=sw6OUhtmit3ػ\vN\# LjN)`^wn6X %"t2"ԲS242QF52+c3fɗ V-&F39^2|E3eDf5hwnW f36KN#3/crE&L{{5Dao:0vQp״3  'DDfdaCWjj:3:3kNg3?'h.>"#3M֚cC»5F>bs5̥3X]u39{j0@ԕ;7m0r]87gE0i^iٺB4vgfmMU2eiKl((ªkMd{8aQc7)DQ-#+55:ݬuU6,sLfnY*36[ EDS-_)2E& OFl͊aJ鳇N1:^l:]*җZvs07یc9+;0SE.6M/uK5.TNfqTq\cU]"̥4SE.6oF۩KcxigMtJe[g3YфˣVՕ;7m0^o9aXՅ.iZPLv񔪉yR9F.5U>J!K ib'ݤNɱ:o5lTl ^T%exתkx\nڪ3m7=ME1(薯c>˅DC-7DNvxNw+P3;WLgwꈪ ՄN9K;j2w{(!SK-yFuZ]ˍj3K{miXF:.xC)cDS]E2/馩FQV['_fUK~&if ~ .. ֕;7m0^o9aYlPSTՌ5,u]ELuPܲ5X6[ƇS(YDܭw5K2:1TfnY"bg IʴTU[/n3mɗh#3bSjR_%˥e;r"I†-f"Z:sN~H9Ɨޜaճ_w!U2Ŵ]NK!mkm1H9(-*"/grMPuD9^-C-FznPZiqו;7m0^o9aS0^e߮&N|='8c5;pE N4ÍUL̡ps0hvy6i36\ub325Q,6TvZ~PW.3>3`DQYlݪmԽWK~.\Ck59ާ_:7,:6+-Cguo9N佂vaڝ fQ%eY凉:7;u`m3(i"KЕ;7m0^oYac]ژX͕3{;"X 1KtzvF6ۜcL;Vq433ӪN:1:;SvK%ޮ1w5ؚMqwmfiya.3fq]eo[; #l0t<[l.Sվl-jcdrf %ҙ6aڝ;K_g>Ks^v jYkL̡XM.ѕ;7m0^o9aݧ a)^s9W3v*ՍP2.ɷ\]n)t-iRme&s}D]UZ'j,54::ND}X˩ga1S/u!(jkD=-r 6; guoKZv{tb8ivab-+*RR;=םZZ-3(i"Kҕ;7m0^o9aՅ.iZQM39(ՌbV9Xe2}X "u aoXPbfSWPьKbj{i:Jzdn|!3ybSv­y)4.w-Fal/k=ܧC|%266G&lpr^ ; xqN3(r,DllGءv{;,iCL\ӕ;7m0^o9a ~QS-;*EX[^2WgTYU1*瑩!N:L(oSLv:.OLۆJ~Ƭi-0tj7-1Zjiwb0{ҷubYze)z\+ os?gRՙֳ_waS2ԲŔ\[#lf+hˆec4:ngw4%[ grEP.TD9޳Q-G-NyiBsiԕ;7m0^o9aӍ.jZPMS9;Kfs:䪣dNMgCtM3FJ!Kg\*jkέɵΪFu0,']zVebyV"tXgioTvfxRo17OmqrF_Wm\Nfx5Ng;b2uQLfd]FmYƭUKTf:4-QL;jaK1d쫊eZPMUNf62|264flVz{qN63SPՌ^Օ;7m0ز\񑫍M-\M0MT5Ltm2}:{LFKK1:l) pei6*ƪM^눦E.LjFv f&sۜ.ņR,O3M1ݮ,E9عY3V]:^mFL·+4·zΊlzoVLNv}YcW_"pZEtVzm:}3: 4Nv56t7ScU9.ignw#;#MtJk:CwFخhWg;M׍Tv{B/֕=;pm*gl[aͶ1L޹^[Z0t-itm-v.׸K~D9ږTX+JvkP۲])3_SпbiO)^7sxt{̝zڮ)waNviwYC bb3Wj/n^&ڈzmXkQoC{K1p:3+Py(xziuoi ;ZY쟔c6v~3xδƫ4ƗB2PZzLa]yו=SW[}L;r콆X4Qi7=FW Liu-rNԴXΗ+,Kyziٻ[f˖PDgdiʹ_/:UXѳ{lY+S0r#;VSͥߵXc+Lvf58gfn^09b4W)KyaNj; xMS9zoSB~f3wLk ivc,S,FXV'; |3V9؛kqLNV&3wLFvN,F^*q; |Xa橗RqЕ<8=v;vWfQٽgjnqjnqj9Fv]W7ɝ7ٍۧj]gfZMOLם΋L+ӳ{8iz/;7RTUV.Tu՝b4|4fk8m1.ՕiٻYBcfӔjUjZ kznv.1\vKe}vnݞQٽєj^Rٺ靛kynV/L;WfY_FRٽjZe)k}nճz*ѕ1SZL9kY5Mm&k&ZIdIq^1y>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/41Q0B#K#]CC=3KCSS S#3= #ccc#\.}\|@.O endstream endobj 2226 0 obj <> endobj 2227 0 obj <> endobj 2228 0 obj <> endobj 2229 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@s@ m endstream endobj 2230 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text]/XObject<>>>/Subtype/Form>>stream Hl 1D-KfCHN")Bݜ,,Avs_+saW]lxu=-2٥Zn ! a|>ȯ B qs&Dnn1G) endstream endobj 2231 0 obj <> endobj 2232 0 obj <>/ExtGState<>/Shading<>>>/Subtype/Form>>stream H*54PеT2661r-LL l,UeΥ t* DMrP0P(PpP 0m endstream endobj 2233 0 obj <> endobj 2234 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1W!P L,,Mt-s@B\z 9\Ɔz&P>+++ "] endstream endobj 2235 0 obj <> endobj 2236 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1W!P L,,Mt-s@B\z 9\Ɔz&P>+++ a endstream endobj 2237 0 obj <>stream endstream endobj 2238 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,, "  !1AQaq"#B23 $%&'()*456789:CDEFGHIJRSTUVWXYZbcdefghijrstuvwxyz5i! "#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz ?Koqqj1fjZ'Uԙ9R,]"j%( .8MV3n|u-*5B#PK0$jY*:bmɐ:"n(,)In%RÄFH5gʡ;q"_$d|18f*Vh`FTUTۓa"qqJ4ujd7nϥʙB$ˁ JR*F73r^TCC洛QRe[B_ fq! $S3JEdeJf~t%(k)*" q\QHQpc` T4+YK~%! Kf%jR {0l丅=H&D򝴀 F°ۈRUaRB*̀YV״4hڔrKTܚmFh2bH$RI=) DZ)) S x Gg,dÄU@ "fM.32@(qI ;m¬Р"f)jTDtMtJ*d+KA-8ZJDM&DO-6P[FGBS1˪R$ElcXZ^qdU22DSfKP+eŹ0@7JwH(IR('6"MF bjĬ"P<#ERT`6NC>b*d'sm1}oDf: $q*<  5JA:헛h6+Y#D|2[R %6[:cP2ʯcwa+ R^MSa 0c'A8^f2XUTչΚ0YBRUX19('~ Pr yŤMV&@JFYf)u)m93"j8gSvO(J3Zl4Xe)kHR xMߓi4-u)Bd'bN~Z˹1iiP״K\L2rY$1$3)rbAnU%03 +lT FC3LƝg J\Sӱ-FޒʑTp!HBIJФՐ32\MI32*)A )}!It!ɐPM **)PL󭐖"TC*J)Iַ:Ҥd'A+DD-,pBjM"@Hxу"Cd!V!g_RU2S: mr@J7KH`Ҥ긂*7:AMihj%MdI)Hm BRR @  S8."1) pɴ8-[+H$**>..2&OfVQ'Ga+6J\a)dیH jB*0HR*@P HTt0R؅(Z*9+e4ӰYZ}U֖'TSt#PKm)+KJH@'J<U+)**,6FT~:-[K IWU36F6m$D9|fb@I HϠ'5eCȭh,lx $+2Ei*d':Cy2xK̜m$vQW5XSMe$6Ց#;n\[0E)]g[5EG0j qզS+76~-hMPBJ$OLP.Xnǚw5Ea%$ ۅR-2ҲSy /} +*Ŵېn%rRY2T ki,PrӮ>dR#r iN려4[2Y- Jwp`ũwu 3EPLQ-P0ITBe*ҥ%Dk)Ua} ʐK&?'2m) te "CA r aًM2+K*aDi|z,d죓rRZCjRf@NBwlNMKc{B ْ )"dN)+ A(p t 3"riLÏ AOw-nyg#rkM8Tmbn7eLVZj֫Y+Bk%M(.iҋHy!J"xY@d8. )8@Zyi&mmdE22JFկZN'J 2HClkP`]Fj[KD*D4"CuMzayQlɘ63Ag渌2HZaeׁR\i U RBa7;?S$R4k [ G@ "@7+&^ 2$gPh̓ m)JBMUE)!uKn"5F'5k{'C@H5TČ6ْ`وL;RҝD7U8R)ہaN9nS,EE-uJAI$Au,4RRQ4%#L %h,8}ZR3Q)QQg:NQ Muo@`T Ueiq I)sc-z$̧)Ēw-I/nnlBi7* AD'6K-p8EVmff%NT@#Y؂ASp7mgfqQVJQ3- %!COܜӥڪq lkBBS軔VQY&2hE-?BarAb /c$IBVCNC ::[͑bU6HQפgnʂ[e+0/UuL[Z@ (j$8[۴@[h(5f*0eo@'3TZU`N::D6E\'9U$߮T% 3{"exWJ "kH bCV * Nx7fIpNn۪)YJIM,]1A/:jPӈPH  !|)$2WU5;te3Lo4U Q[9:.gH@MS2 L"CҮ&fBgHKn)|TXZRlУVVhdI0rdKT31LA\)'&u-SP'u)@n>:.'qIH~ XsĈ$ЖA[mԧ Qt ۡA{2Q oq*0ZRD cITL!@6m*a")z Nj1!.- K[Taģ0% H!SΑX 1l Q!"nS 'f k @6[0㝝D[ #b{pUA@Z3 P@XHd,4TJف sE(JMdl𤘌ʐڑ LHAJ%j$gұ*:ZVLj 8Mٹ%ٌ$D HZ  "BQb KZ;1mA"&e\'!P IRAֺZT4$% 3FF!~1(rj[fL,"+rĂi@ hֳ%:RĪ2REL[a@E@!%V j#d܊MBV-V)#C/0/!^JeMjC )d:äȕ/JRS !l*(IR2&. 4Ax)I7%IpTA3qa:BB WZeJ֒n$ԙݩ nDXO]LNE=9JV !e)TTp썕O}+X s"mh{o2ˁu ]IAA0[n5D i`B@*f A2 SATC6qc5 P .Й4G&ƶs^Jܡ@̡R#LFSr1*xR@u&0Ӻ"D-IS9Z$43&*~lyZ jԺEJƑrV0Q",q%‘Nf@IMqBV JHL&Trh-!+Hɰ ge4*!jmJnIH7OBd*șBAluJ@M\۟t)$] D<,M"GdnSJZpEi 7碛q %ZF`iM(ZA :kɾEp-WmK&$o`^-!Z&u%;RLgbv2)J~-% I6 ()"/#d6fU! *Q,Sr3 !D2%*B},0s26mDs2Z&}JT$gV8%–CNzN(NF@,7RSGpа JŸSF,Yv 4 `lIY! 5sQ" r-Iݩs7dp&:bITs!Hji5AR4JRRfZ@ N%9mq#_N$sPtڄ'RP.՜3Ӥ@Y&D\E2l"ru,@ Up:XB-YIC>ۉ23"r![z*1 i)'*eFIPyKRHVҪ,դ"H*D[ymPz6=6FCD4JVPTs$֞& k&WUVkUql: 1,0ڪ)9"A36L%#:)[}/TܭK^w)S6cLc\Lc)YKRL-IpХiDRT]U0=ڑ*N/8B1 Uj(P"1ކSͶ0]i Erm lZ3HUU&.}b)28ԕ3W߆c'S"-Delm4?d"E3H#2g) 2:U#Taeo@Qm F;ItQ&FJue ,[MfXSkMn}1- 7f'7 TI i%MPRVRLOCBP͜z@$9HJdґ! ;q.3T3Jq RVRfH fO*`aH+Ќ4 wVVIeN,$lL4E 0Iu+!2IH8JVqQ6Rtc%٦M)r$Q EcU0LȲfH*)0IH7ZV]_7em(W#$!Q!MDC@8ABQ*bi9؛i@N"aReV|O A%rghR,T@4. UHk6LIEʁ@iQ/0 Z2 4L1Q&j*i4JUY]xRMn'4lҨ$zuRSATJZ7gcu-yRvdjh8hLC\qBSQw١H( B oH2J° ]VEy 47|Br:P +VUNud@)B5$VtXHR5[~PD*(+3~u6/ ZҔ[P6Vl4#3 >(E"iFɦ0br![$VS}#eGK-ᚑbV k cNzeD$XI$m!F*!PjJ%ST%D("Iá>WJ+&IARLe2rPmT^!SXA"GJm$FӣMY7-[qA$ ȍyuU!aVVE6+ KVS1HXeg* 1}#eײC%3]u(&@ )EYW IqRCSRPB*Ik"8*25V`s^#2HJ*3@t4H[iJԔTR\! mBbF|)8P4ד1uXi9R-êN%ĚK9`6U:KJZm)L07 NNwSjaBᡖSx7LLABY! Us*PJfM[A!Fq.ˊKj[DX>e4øR\IմSSЦҖ$Bl8/p/CÄM )@N'Z$lBbREpdu klXš߇i )"DFtZzR 5k]XB!IhMVԖ- kd%xA5!B+UUi't/T ,)XH8x_MG+fM (-Bвn5%«RNg0MP Lѝ-{q[)T^x3abj>lB[H)6)-qL5(NqT3n\TBN}A/$6mOH(&e7:"vE5̡$3ϖVv%Pf"gm FJ\ԬHF~"ڐ"&q) 3.-UT+]'9:t# B+*@8q8@o7 Rj_LO8Θ# !CC$(eS,)ZxA8$ |Ƶf-C5ENpBV DKnV\YJ34$0ZԵ,(M2쾔6 ]B DIb7gLs@Ʒ ;( Y2Ufr/P^A1mrD3M&-b5"{_bEx@PQ ÀE[I+MռRR2҂Nh EcRZ"SR.LZfR捜jNSlnI!K.0H$mAJ!hK)} 5C$mMU*NXl̜@B옰ʐb_]DZe$Km*@ɑ lTYAJ%dRnHeb4l ɴ7UoVҢd]8,B!h+)r&Ffy޴YIM{5)HFp:b1N:1"д"rQ}'L܅!2RSv H[I[%..T[sBC4sdD I endstream endobj 2239 0 obj <> endobj 1 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC/ImageI]/Properties<>/Shading<>/XObject<>>>/Rotate 0/Tabs/W/Thumb 2087 0 R/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 2 0 obj <>stream HWko_¢K(؎&CApSDYl(J=3K=k_dpwsf}t~Qntj%z~t~ά(¯ݬ=B[+[m5Zd(Y̼jФ_|GJ+-BJPx1[:k_iE3o< e4,$B➕Ēpd!}g ߏ^NFKD ,FtCLꝶEEn^?sUbnj{q_Ump[7j.vu3{QgXLb ʾ\bU|ެύ qv}5-`f:1mJr7WlyȦzKb=un[̓zVV=eC]S1L جa}$T5b^oWvV,R85:FSjESj&pgYVJ"W:q]fl۪V.okND}5[f} aAbۊ-zo!4dα sqsr"&]nkEuT{@s0r3V~ cKSVރl EC aG!+fmP;d{݋elg]L]%Ej{1w$iUKGU}^"r'6>9tP54<~=X ]vFB5.c Wf o]o.xyy!f䯀D8cBxHcm ,& _ԅ <Ӑ{TPKXiVyQҝz׀f'pKInt[aZSDzDp{br̈́+f_\0CNJK|҅Q\!K3+yLf~ ^^|xu{H XxL{ L"&n~y{-~P%l3'#󕸸}|oY$ޏ,Peaf]JP0!|``X.<7 t/W@S~p$?b>|l !HvV.k)j[<}͹ ҹE]&J$ ݢ˫)Ը ֣s7ȼl9m۪h ՝IО >=A6}#3u2i8{Y! 퇊f﫶bPvp@{LtudSl-ucۮwKAիMQsas&r{Țjiv̫MΧwuÒvKuRF`Oa,aZ@Я[Dq$s; t4FF޲8خ"|ZJJ(c5 w)-|WpL.#7CRJA't=2aFa}EOQI3[U)'F#%h:b9JôOUFVRjprI-a]:n/-實A{1FJm`a LsoveX iCLDqo:i"k٩2A14D?2^jЈ@H%|Th F-* .745UhD䞖w#,p+6I.R?'׏Q@`$B+ MyQ< sN0ܧz F]IL z(& N @ `&'F@E+~Ö@q:LޣBirxƣPt ]BJcr`ppcD<&[W 0\TBQnJe! xGsJMkS@L\F^hVE+F T=Q`4Q<֔KkE }btk^%F^_? r5 l`u x#"9h&J9A07vaYuM)d#䈘 \1ٵ]P*I^tHY.q2 !nYzSw$;Sp <>z߃{wG;ta:>/tܗ͆?av)(>z:ܰ?0~ )?탐XN,5 085`LE@E(@Ar1DDC76d4UXK^NJBM/0|w-uQ$-++$yqh X^Eqd(.J4}avZ=zۘj:UUNuH=ؑ(ʑb|S*&R? %ĉ{&1Ⓧ;Ѥ֤*$W!]tܷ~|{Xű!P,Q0ki&$F2T(]hf "YCCJjRY*)SszU%&'ò&[Z '+ իo+1s k nAMD~JP 4MJ넂4" xgob{cnw%{ƓN{Xsn@`V:q )iQetٻ|Eź$?iIgʗ$R<)u| jN4YU$L#P?k~x&{7֏%*!(I/!ŔkMKʟ%!jxU3&sG{iMz`9Ʈ̈iG~,O 5 0Fc΢qF{=OS p=ng$UWiqDԒwBysjV(@1ЦMx ~hXz-:3QNT&%Hx' UWJƱMZQCȤ_ |RW_yÕߎW*j|9k7B݇-Kk"[Ua6;g æ.=A QU Qm_Qef 529A+v|;H [ݙS _^P Hib3|7HE#Fl7;Oہ|`d- (ٝWLkiD[猪 wa30xˤ~3؃cE2 4ӈ 8!ƈ&)ǝ=!7݃-j9iљn6 ? ma(6"Evْν10ϐ,WGEFI-K9Cmesa"cf8`N":v".XP92 22JQ[-2߈S99dEsۍ8 ekujnNաcfo=7^Z7;!Kgts $])µM=w楩xiE` B?+(5b/ E /f^Lr cZ⍸/>O a͉;W/b\t˄B7D1KVm ť*] nwǟh _ßL>в7vﲢD`r:>o<~V3YEi9D*lQpc1upw6B omeFL2};sic3!o(o2tٵ;>'e=FV$UCL:iߘSLfn`DgU>Sm5H`:kQn)C"cBX,{glVF8"ܕZAsS Kǝ1%NMR$.ו {~tR2D{=ߜ6M %N, tc68"Ä';Y9db_VL?!Af\ H8.DL؏`2^r%D} dx7T"KhT MynQf=D5,`%|#N?OhIBxc:)6nu!TfK=^ڶ7"#+'޾6$KQWD67}t,22]n*d(#5}s}mꏽVO}C8BYWw J}ȓC]0n8agF[m0]=p_j0bIզi j< 6PM z^*whhh$!PKE `N?~OmɕCSB ,:#eѽIgb@łփɵ N=~J! S_V9VPmF3(ӊ?ЖԘ$P贫D1dd;hhXke,6)2  dL0W*%H&Mw4xD#Ք݊܀F[,wPqL:8×`4rբBu?GF6* :|^~^ S4:`^h(# m#njV_*ҬCGQ+w2q'v HF('DAn@<3g$P`uM+>@0dAP$TѸYP20)"6فߋaPN9$0+<:yUjFpf2hfggݣ&RVU$ۋ$qGa3%n9S/JwVeD һfMDQ7EJ@b*h2M6n\RX%O=:xd :S3d06~~±r(7!^ߋ-JǼ0žEM21ڶ(ICLgVLrDq3{狍_r|DQ57I?TKdP f2 ng3!rWs,A\Ih#([adbQ,#J+}:ـc= F dsn9lazG4[/Zn)!9Xm]vkp4I r7c,Ȝp 8`6#Q I=tNHCfPvxQj TAZ?N! jsyTY\Mymn*RjlQ Ҁ߳lCvWʤ293 ?9j!J)>lj$($o %IӇ̖].KN_Ri.wMߝS8a}{Tw0&1\W`Edl=/mFwpc0 vvũ0|dYJ>:D庞˜zjPV\_RsW UpWCQ|(>$IaSDihCV->LL(b\וy)tf@a/oq.h/WB([Iz޻^rf49ͦ1zAqe>~z&@2d5:Mp@(Ny^5gtgW -K2vUGFqrarUy^S4WVm|}-'KVW+3s+۪^nFy=}t]|l -U ϻ~I ,6Nq&Z44w̨<># ʣgG[- z" IIG;*؃XZVTKyѮ F2JH3즇`ff0_HnI#Xǐ@Z9Ne/j]t5)^.IIj Ƹ%?CsyFj[8C- uGk ,ґ&M2fġ oKfiQSޖ:::XqR3At5P֓M_ͽno0˟Ȣ=v!h ӥi.56QJF3LL ]"=Lf64HMgT5xJhҸhGj?_h ޥ`˸6Ή*b l_a%v+(es}$<';>;16e > m!\1 V+Q6Έk9TGh,vPR q%x+}HbD 8p#Aೕ1ELEfk Q*h!C?څQ݉sۻnkyZe4D{ogkF >s[(X]yyFȚ#6ȭ΄<ƕhvߒ;hIs]QR]; PAx plKҁ\'.bJrKq]) Cn[6}H,xг{k5W.A2cd^oݎXSQH WG+-.p9RY3Oo'17OpE?y[OfUQ"/bHg '2 Qqc)hK1lx,4*s^I*n?'>}]{b?Bz1`zyW+˵kC'ةiZ#jm~ qT4oqHڐZX؝8 !\.i&z b曢?vj/~iU+RTKqF3 | VD.6W_4YC|)MAyfq:ZyM8pSPoYNŸ)~4-m|$u*;.'0*f1D wP*~rD]8'&"BRg@+/Frp$ :ʳ U/k?"%c. l}KnrNRe {H<ׯlu?: l>H*_isO׻4znPdzANz)a`LVWC{.K_ȥ[8w`_?D z2ҶUgP`˖Ti8h]Y&x) UǴ@E :ڐ[P5n<1gܝ"1~Nf+@f;zx]F68'vsWL2O0J܇M4dqHr-A]}0>%[" }=ˢQNE2knYbo|. 챩gFAnNP._? l9P4S,ۏ$ xv)|zxfR_8▻UlRa|8ꪭڣjwլX[}qJ4VEGLE. S-si% W)tb '&"`g(3B2P\ƃTDVv0[PYDy銋Kf!u#I)=vºf=+<"û(pSAh7BQpC|8zc(C/ڥ#l^8Rbv"rcX"Oۡp8 :kBG}rwr!Z[\iRZނJxz}z#oXsCLC+ӼQWXtUnq`|7 w3IET6nGz(2>4/9F`æx|5QTdO (3!{Ɇ /,6Ύx [i<3R="g~xzz@0( !j(QKqtiۘfw:ky4v^jɱ$):E]! arr_xx V9 )Q1s!`|AڜOWdψuXvȾ"#LU$tdzwsgrڈ?=`L/Wtю  GᱮC4dBd;1>2a1{IGU!ܮ=-8gXVm,v9[K54HC idUD.i``a\nMPE5JOb Wj+'b;QZ5?Met6pR,=@{ԣ W jTkQ~Ez%#2Y#TTV n70.3G=!:b\wYcGx}hAn%Xo/.$mL?l'7}a5ϬGd !`BƌiS5 RD$ރdE d )l]vL$1| <VaG5t["3W bxH^;;&n<@zA|FO)Ml+v,q D)n;PA-}p2ARv4hri7b6a0hFЬ)a,@2Kz(.?jVMh#DoZV/ CGK Ց$r~3b QwCG6FYf}:A\=|$u @"L>\A]=}hq0I<7@v8!DyLoHTKJmk75Dn47Y1U36 btW vFO`7| d\e7 ;iwjlfLK)|9ө|ldf[1`] [Ql?G50Pj7@(O 0ɾ)@ A:n]HA@J݀`],Ndfׯ˞l * e4үͤ-MUd,˜m?Cf0l3?d-#-L$$fIչvOa 7 䮱S0>"0;A~^6Dc$gg[՗{ζ>3}z x4wzJ=nu jd#Cwט/4 &&!\o\I:,{'8WE@̲XcqVɇ/jY"9\~F[m4Kn){8xE>3TgjY[MBRbd\e(IzylՑf1)ELOub]"*ɜL#: "Y ٨h2(F vmd j6T{qrP41RB4'P'37f:]8~;}$҈+,aedI/cTRSV#`QO%]r|܀5:U%\hjd4opX|* <.*R?wew>?>+)eͯ )ӟ9'vpɫ/p޶TkASeOZ@vk[͖R[Eb+鸴TiNƊ t>Se4e@K&#]Zeaq)O ( T9]gS JV u׸&bdIPI|Y-ۇ(š&#FlWj\tcı7@sÚPOf-uo%#^xgs$52 Rzߎ_?RmW=Q0 f 7w)Pz(:Vgg[-JL͈:-&īMM`֢&1 M_ #FT6s8^L߀1 s[؊yQD!ai>WH <\'4{ͼ`Q~<׭ >ӏ"bhR<<> FNߓ&U),}m0TwЌ+!οUml NV*6+˪Ѳb/j$+.46Y𾙵96s)i2]JQ tmWWiR8r&9eBK ].ˀjz JXq:pyxJyT '٥?UxX{l'=4ѕ+$JDW { XevyWk 𾝔VpH2kK+'qf+ ]fOn_=-e%@&n;zFVAZK;@_8rGk*H'CTYEqH۬7y>nir7[F[G?}4hXfOϋ3C8L{H>h,W+PwgL(-kj@BMjYbh4Q4#e^:oTuKt4%Ÿ109ijɑd:E]ڒm|fm6AeLIA>_ hG o$?jM|5﷨KCfXY9Ba"7۟w@4f*B1SJ%ơZ E6<|"]'H?;)\WN:1-  ,4T/ & ._N "je佟M}0_D$? C ~f(k0NA ߷HX:vHu?@\kZBI|($z"ǚyS~HfD6xb1QQ? ̾dAc)Hr ]"`u28@*$UW)A$b#94*" sh[JԮc*|)i7Rnj{ŒQoPw[HH*(CI t#: 86%!9:؇';.D=bՈ*H8pfQ:`3Ѥ52FEEN5E<0vkbu[bF ѷWܚVFgɀߝIH{!|by[Y{A\gn9Tg+ Orxu4-opN y|MDf(krYQh->D~p\/rM.gY,[=-iZw<sW*}FmÿʛD fL %C*`(|RU[y:KcĎ NFqk (h?tߦٮ:OܼԆdp(KYJ`_}s,N`Q,XPc|ĴP%xosÞqiS,rfBڕd*ѽJpsVvE`/s2ppFWƖP 7d >}@h=YNo† ZN_W/!s8@w7fK g|gەW A{9Bj{ !Nh5 ^ tp$ PZ<=[qn/DvgrW" 9m.v\_Z 46Ԧ}S{pEWz9e蓥І=q/0@݉0Q7HP9wq? {ŵ5gWK SUk>0Ÿ]}@'.-u;ZjytQ},f1u500P P $0kY-}A\@x3l D7u"lYBт@ZNauκtZP9h=}ѱtkcIy%X氌S :╮ T W:Pas+Z1>XҹDGv$oYLwXg=YNhߏ)sN|MMgNA+> 7LǯTte\"s8ܟ?ܑy48 nc_gE1OXAp?&cE4$NeKK"/XqB"|ubf8!!" >_/X]?aL.cE2ГL##=:OE@- +*pS%k."?8 *Zc?0cdnEuN;"_%MlTn9Sƥ28mi65-&_X<9kS;?iI(b>TГ`J;W85GCm.6ukY\L cҷ  ipkEHF,ucFUD pEUHn ̺"=b?2kRTe^荜v vƕX$ϵe}_vGkT0M*r*UHcE#9NJ$B#w,M%xJ~??ҝآ+\(qzܺޓp_.,i8CxcEBJ Sҙ]"AcoR6)#TyVcͦcy)looJqN-r`Vh(0IAQ2dU^R,Һ?L"=K^H^цX9NJ.{ba̒*,|fU2OfDWb$p^9#C9PYv S)Iu\m< /v.~EE =/dyj&2dg|h}8\M"y,sentL^f9Y5ŐɞdxcB̏`jAe1 n:r)~w~?} C-ZX9q|Z;(p R5x oApɈo@@d Q]Li`^5T5n#\cz$5ψsǎ,d>cfMLbiNe! |ܷmzA^r !A>Ǝ,1&5$ vz$qvWCue9UiRŕ2 Cd`$jEsz>Ђ,R5lBZ6W֋{:.&+=fDvtK` D^CE)hć&ctr E%5Tn ӯBpSf-A: Fٟד96XKi2;G~b`zC馬#!a_D&;!0 =ˍl&_-a. sD.=wYd|4XGk%c,7,b2VX!ƻ$sv|=rS@A8,4L9(0MۿL9같N9}א2]1dTd^ L"cOgFg~tbDn1l@jj=;C3Q,=p/{2ǍInI ZJɣh^ NF *wJ ,S@y=pҋ>v(IҲ XŒ1 Z[2< 'tKDTe烡 +!-HT17%IPwB:`|F4߯Aliw%LQI~s1GOFg&NpdׄE1AU _ ?Kd6aE4g/=hr0X9hur(JU6P%A,6OD$8>)br4V 絙v^̪$w⸈aN , Ix}\m;Eh>v"ÐF%NqtК4:a#$ߊ Į܆1BiE-''3ML.F \N( bD`Q|o L f_BXvu^leA9eNBrFur3"9!T)7BO3&8Vf +Y`?7Әr{"L$mԕ8ͯ gD\:FFZ2٬,7BL8#"Zgxl7BÎ}Gf %Znlغ,?VqV V u5@h5j!FFt4gFU: N? fyj;zZ!ƫY[.3]]>ub I :0aK|#t|A!Rtuu#9F~3BlB̋Ž]8eruWd/j(<݋Fmz4 ʧ +X +g+l:u_p\UW E٢>(䷛J 8BL?.L~`?\ppO< t|€rj%AlzF4qđ_ТAF`wh>Zwq{׃Еi\y m6!(gzE]sAEo"q6};lВ)GDF$v@>NnxժX)orÖg1]nwFzM->yu3F5cQ- Z0YNŸ5~ 99k)> ;d#D,˿ш83;id?+l`gSF٤1g["4mfmTK%jK"$>fRRo!Ns-~oE':’N"j)u5/7؉\FN2dLFeչI{.``9SR.؋9d9^AjD]}%_ܵδmִkM,)uNks8vv?p @#ȅ-آԷ} aL: s$U-QyN|Ro ED XXa$ mıfW&EXLi[+K!ZeOvd2V_no8?~8>p:W,Xϩ$جnwpuC]5v@_=կ4VE0}l6=! qW*3H/B%[֤S7(mA?R\|#iC"N0e;&)kiJ >.n}4"Zq˲RR2x6½)ZR=^p΍8vcg%EOL.xkU 2|ͪJ7/<#{),q܉L6Md ʃZz.ծ.E!͑ 1NBش^Y?*E_?%qVνl izszJ6vbU=KuBH^#_u _OvIb%wwl V+ F,=tZv]-f37 HLL*-iu8zڑb}h2+aֹ\EƖxPyE?K %roAh[B@j0P/ ^?E=!F9#f7b<LvFx}09 Z.e(ԼBrڨ?E_EN`Q63Έ@j.9g gӛƠx1[4(tZ1 A/Zy.D9߲t'gu_b xYJL7y#,gnR\_R'#5BIdbCXO4|.@EQlDAH} xpZ1(o_f !JP* &V3n@(_DU_?°)bC=<@C8Et+ف#DF+݀T_ipT  _"-v؀-6IZqL7r *#l]_ܯkG+ n[p77͕ݙ,dgȨ xY:.*6萫uSieV_kd <!SQ:Wu6dyJcܤ$t*rҥ-ndQF:H-Q]3#̺X cq[Ԇ.-7Zɸ~=S5#[dNqa_qv&,1la秸ftx#.wO$. sZe:#09Y Iγf2^S *j$l@JՓ#_<YF[vؑ#C c?D7t^V==k^)&3wai+&E^#K6p bH;bt/Z8 =љɯɹ(6NS;`K/ )Z [Hj0 f˳Bl2X\@G09ME4܀8?BI 'n<#y#rn;r(q;\j,|jWeC7'seXEΧ!:{hbN9'Y:Nʕang#6`SH!M ND9Gѻqy%*y,n?*(+(3:'I$5x^?Apm #W$Y\mh6!(4yweoʁem; ;N]vzi 6tp MiN:O` . ◥УnbahlwOYW0#.ہ`+iE e,v%J'X%%rqZ07%_.ŽҪdyY]>;PK(Phbr@]\cHV6tYkE#8R8b?|ahx;o.cApZ3K:+) .jEuOL|Ώl?#;jp->f Z> {6%(8uK (tӞ cJtL/ PBS1Vـok+asH[bK$+8Kq-*v)ZufZ0A*$Upi˾k4jbvy^z>pr @1{ p۠HN:k/-ңDl;5#͂7d4/K)Y`Z(v78?[LJ9|Xʂǔnt+|5qGKws>60]/ tEk~M$pBQyg;+y-1T8`DAubF[>5;-ocފfJ!Ce-ZF2GA@L8ng!uLb@'oF-v &||FH[HC RƌC>;VҶlRh[ƘDaPck3aqŀ0^\f:X1oeȾH\V"`-ۘd_6/[K d7ρH: {cpCw@>:=_#4}D@yp8NʍL$!W¥92(D-Ha6a@_ځVյno!J/l{6pQ VJf24"5 LCPs"2lm >x0Q٤8`,Ek9FC@ )q e}8cZ3grΑ@ 2ӱPBMB; j![ʒ zArG0mR$.E}<P+Rǁ(*ԛԥB B1hHO,-dB;?z(]S)Ui\R6- 8Yn$ 9bUHlgs>釰2R++].y[*TO#UOj~{%/Lqx6IoVǻX \ijxv%syhwcA1-<={EKumbߨ羪oq۫"z.TD7$ok:~=HWIB)IIT}\+nQ% f#3:nXu`v<=ދ߼0S[ЀgKHuՠU5nIޓ%nFXTDS2d ސ!Tdr9X^Q-uS MΫ5O\QMj"cHU++ pMbH,.VpRZ]'vg "9Ő\ݗ #ˋwV, L> -^měg!*V݊r*,+ce~{>~#'gH4^5QW͐BEk8m- ;yEE&:K8y亾p~!+I$D|wJϗ2@6ifc>,3 Oj5Ii y'P~@K )'4[o+7)7}&{{,I[}}Ob|{#iMZFYn+"C0%2)89N1w_?PPr%O\ .'Wb r0>?eN aEW#5mƒļ2E*كqHS9ق9dWP.,i홺j?04a=e*R7$KM.fHcIrX\9jK]|35RiL8ճM\ KS\"`e?mf1YcorsI>Kqqq>klCVHQ'Uj]oM\D-vE^a1<ܧwSO?rYy6np:A˞L-.t+M|#ޟEygVƽ'L#ߎ Bjw8Ҭk\ƼB9+7>) 0\==~9nʖysCz|{O2*:^FŭTahD= 33T{0Tiފ9˜E$.~6?j9n:H9baӏcʗc:w{ދ#KzUY[s"DVF g9.q3{.o\Sn_P,OJZ]#n&2!K"Nϧ(6$yĽl:"=Ƥ3ZCcOV&aE5ҡt3:r7U"I: +-qHyiĐVoߑ ּkhyVD`P/E@Į]h$[SS-F|ܥf,sTғKTm6a(+ESiz>:d )-hCI"uXl뽚O99H[lFx+MTj}.>޹ɦ(1"ZDfB3ݜmņ d+pƋyDZuܯ5qœQD^_F CZ2grc9#c/aqjq˪>p) xQ6Z"J8ZBJt+ϙU0ܯDɴ4]'8P5?)vA}y3t #tS^[kqC|_ă 0Xn_Kw}ua ?]v#cS3R:"_[_2M0*Ucw8PӄNDV4 {8}>ƕ7-Zл (y&I* .pPo;z#hy_y RC肴`Z!@kn,M,a%u9aߖ{fqlSg. _Axm#I53SGL!lkN= 5Eԃ-Q] L߃ GO&^EeO?>L!TSsp=>p8]>KQ& 7 Ai x̴X0{{KsST@ɫJqjZ+K(fVN൥q=`]+_ߴl?qɽ6/E2G;fzs7X4CnxABiza]_tEpȳ7Ԑ[[7gz$ Yʔuu؉㏔G Rv3/ #$.d9/SMA/L0قSWt:-MjͶzmņX?6:Gț˚dȎP)C"Qq.Hކʉ#H_"m8˶Fيll_.t+yYZd<['Lє6"ih-&t۠Gg*J!``ݝלdUbM0%.r&R_T{ꭺ\>2U鯢^e˜k*fu!55=/=s2Ό^Өkzr5Y&yai+"}/_3i#NS^b^ F'^S&1S@C1~-8-iQxN,e=Xhe4Ej6j[ )t .]p@ Dz[=Mcړ6v58ٶr㎤{n]k$H2.GlGb[m|#j^yOhTٿjCcp@¦*!N,;۴v=nҽgJ"h\%ۮyB 9"Ipei {s#v&a6v_gnh+$ s&UTת3d(`w|,Jf[ۋl=ӳL" C69V8A䑩_3'%a~VH xr.wU%5p)6?jA?u;/ѣ#`o %FQ9^J׮ 5i4tMh)r3i9) r.vЄp&~|A Cg~3{\אӞHY;I6sT52UHy,:2cX /+!} Nv՞K,ƥ$ӻ!p7#VC0i+^( -OѮ9e*j!cssqD{H2=PDQIǸѢ emմ8E@ɿRJs?eЭġnI5v ^g*cx`>zO,H/4]O&v2HZ|8O.05Lj!9Tm[&׶z/a`/^ŕZc1]4.>nהgJ3R†d`=pdȆdZ4aRhb?BQ,PTGbo::[T$} W92A"`=aKv4NKo; tRO}.;42sHDT3bLcLrMȩaEh;Ea"H&5h~DmhF})<_,ɒ)|vw-kSSE\o}. QsD (ɜ΍/1ooGrzjT5(ǶbEkGeMVZ)Rᬶ7\6gV|]_?cjo؏7 ;`M$yF~8~v#LV"Z>şRQ꧸!%*^ޮ%_.ez 4d>ɵ}21Aʹ%xv#4\Řs{hh˃f 08(5ٜ  n4|B@pA-UNH/B2QxY (Aـu`SFs~~0M69'b;ʙ}8 فHhf< !,#>䭌[H۸NjT+vz̔q#4 (\Ri>0 d{HMWƒhߣ(>'- %L\/3+%GS@A[fPqDy☽~hhæ?JjYU(Z֫``$;fGe5X `xd*fRU`}=& 0T(`O%A_U/=߳qO+'6⳶1":,z흠/CJ]üdF.LZ5=ax[ٻFF!dLΦL9#t 72 t TW)LFيlWzc7Ʃjrڍsc6%[H뫀nRbL6A"|.@Qn(ɨ,d&aB8I9a| /#7*` TAbȃ-N@ w%= If8[/k51Bf=%tݠ  y[ak4^v⧚rϑ )M_#qAۇɥZ 潃; rR 0'Cq(AwbUuYGR_IfkIMN%>S>cpDhS'1AV܌ϯM @Y{'Y! bq-&q_GL~O35P:זּۛSHDpA_x0q_7Sb9)JS6T}.X:U P76 3ˆ&:k@z Ƌ['ŮzP79V>{Khl#%NڳZ6Xg9D+x/xo1x$I%ﻜO(ٽ(>]JE{+3|S˵JlϵStjྭ,#ַ$j-'&mK3Esʼn|PysEbMg١HuXb$_DDlw\(K?ՍQP.` V7~zvB;"I!M7FYI2~@!M5]lޒwr8ޮKЈe2ZP-sb\2tdiRӺ.Eg["?z~Pk1{bkg1 H$(> `04Bbջ3"Np7 C.-PcKB֥ƅ3/XjpNWbCjwlRhڙQRh"#`'>#'PFnש[2$`v&ۺqgRpe!C,^DN"]Wݴ#7c*9ѫD?PFy` )ur@"Hqk}K-xx\3'U: )Z:3A| aIwS!-BF#8UcJ5\BxFɣJ`V)fMS?bel~+5y3%E홡 (bXM3vɦ0z^" SmХ|ܥXt_"@ M\=kKj6]^m^q#Mj QbZcjt 1-ˣU?%t #ʛZB`Xs,ۿhģx.u!+L6XG1لKL (>lKL=ij^ DU^ڥz@Q9mJawOe| է0w^ n"LH82..덞pOڌ+}z@vy 4 P}; }%ߧqCn@&~Cf&Q <.V۪3,+y#>׋SM1̾tXl$Pu < ]fn JdϬkTM cSPfe`8{1ʆD|mSɑ⬸ yVzDE =n2w.GhGI8 X%GY҆Wt΃y۾,Uggֻ4M$aZ#uާ  ?d&UewoK]՚[62%"u`׽j\唷jeU;xU"y2=)-<ũ:C͗3]\p=|zyc kVϝ% FCpiΗܐvwAaᐏ¾6~?fv#lA| 9Z%raq`8Я=&}ĔNl맪V9i,y=VVt/Uuptit!s`֑7DW?(gR;oSADZUhUYf fm'[Vr]⎄kVOzm(qJ?: 0p锭j/ўu* ~2Ύ蛰XX 2uoֻ!K:bÿ؛YaCTj!ꟁ?놋5K`q]$ -ˋa%p Nm֣pNQ4ͽWB9i2Sѓm, :54-9d8|GY9|B vk8doDDl@ɤ4jMv :>6*ƧVh\`vĪVRT:}N=|j嘘v' ~c_&s͟GmCmz2PL8.ErL-H_|Ad#_I/1%q1Zr a<7k/塬/D~;HIM'̀&IC+2_y)w[7n;~ML?I_'5JAC$i0 `دvkvW*yYIV֘AڎF[7"77cnH.Z0zi/ &V?I_e;MIYT dVƊwWZx޼M1m[}d汶Mǜ7h(FdHi$!K<:hFeB7݌se(OXBT^8=a Lή<`9Ɏ"M>P֩1<4R hzY=͂%{f֬%}_C]BDsvYa}R]l3d6&-C9,mξæ3lwvbS]vb>u ÏmVJ ?ɠ^Ha: l!b Z8§=@~ y{pd!wƇօRDFP!NS?\M@ º FME*tl.v&WU8N-lxZS |_ <ӃstFDO

ҳ˦}5b-;%xcvڴsjK7|Utс"{W {UVk3% [/Q.֙cM-#47m3~Ѣ#vF-P[iۧ`:sQKHnRq}"eݐdи}KB&h銔9IC Æ3','ifbqf)4I C2#>UM)@PA74n ]ɏY?V4 clJp>M`P8}h"&h8IaB" kA/BzGvpԔD*VR~]Vg<28tZ6,vεh ;:f,J.ZvY`Z$kUU GpT<ǤIx:n=T4#/j]Y(#YTːU1J[NzT,TF]x4lMb pu9X2O+0y^p.˅l7ߣHMWH^fNc,dO'>DO5NW__ܬeUC >wMJ&0+azmT-LasxViP3֦X[:q6%!=GvrT K,EH>6W'TCp[F{bI\Ͼ?#JCbJ3 К1?E!$LC*zhb.QnHkSX(!<1qëqtHj:fN̙OOt%+XKE 1:ޚ2ֳVRڽ>=?R#nI7؟Fi}Œ>pvn5j(+6 8qB`FMƩ:1dPSVu?i%t+ۃa?ՅPJLl֦$[f`KeH~!3⌊j,~J 9/"V5~ $E6Rc$I], TxE;r=k)SB}l}sg,aSLZ+[ձ1MSaRi.#qtkt *TN4(/XِO JWbJW79|_0xyD{zx-ؗ" \G m٢` ^B&FBԸ:Hbg&m#Y2R!]0bC*JPHa;F;4fX㰔&boi-.[|7)[ JzMoS hbFlth;Mi|Z#Ft"I,yy`=*+RXTrQG=İc}CNֆˢe!ӵvm`a.:6 >lіGWwPNһ2!CW9tGjH ٛ&t7SvS~UA GɔhˈO,vђ >@`NX,OQe{}nZ12UӘIWyw ΩgbOP".9mH 8-MXJʚ$ 41eͣ^YJ{c9FGw]WP"W\䥑\lIݝMY`_]Rf:mM췖;{H~:3nr<2b7+xs R*27  ߰| f"U((DqﷅϻkhȰbQa&uVȏ਎U -):ýDM++}A~$ 05<ŠZr\Fg>^8|8.&ҟX5[q;bi$b6T;R WzVg[n: אh`ə0^Ve[ת1]vdE&- 6=TYCb)rvcb1yP"!ՊopuՒh j҂:Rz?W~?u2Rg]}]y`&*v J5_wrs#6"[3 Z! b~ӄZ"!WGe -ToJAղ|Yz R*i$ I8|L=DeF6Չ[ ($jrRv$./1@[4kVelvҮC]޷>1y|P'|JsܧWF(ntMG1{6YִclɶBFk4(O;qoTD_OGs1^6/E8M6!:J9k׮lVJQc9/X0< y~I$ۤrJP zi+1`ڦf1}Me퀍A=,pD9I#\ o@i+nx`#l*jKMyKvR^gkQ;hp^w0`Of8,߿0%uc<l42ÊMݢ0md™z6!,w3,I.; &Azh,T^hlSv'EF Ou/kЯ.* NI=Vi`w̑_MRUdt^!4EnWn9BV~G"̩'x!lxk$Yt6C?ΦrYCBRdy"6`fh=|sTׄ́ЦqjT# LDV:Ҫd&BJ}lewc3!Ǒ>csmSܤd%Q-1N{KAG8ˮ d;WcAoHƴh: spRFMW4PTԓXu!+@=b~sAsS#n%g!,+faDvI'LY%.1Wt5 ;R`{"" z.(^)b[Ȏ[fQ,M@EE9,(,&s+Gw[^G+fT2 ,5OVggp,_(.aف'3Ao* vANį|wwNpIDŋs{ ~3eOaGnjnm-s3>f^pplkr4BbztKj*n4׌\ UtRv!s+ުo8FvNR;rgMATyULg ;c\G3?A1OOUMk]5%IJ֞lݔW?QY_tiXE(Ju'$ffUqxcab_j䢌R m0[Y/3wttUa!32&axB& 9 а7}@X"=վ$@#$^EWϙ=K\(ל{V&33Ш3ƙƀD[u; ;2ڧ>CZ|QU|PE|),Ԑ~ ۡTI SJ0y)%)D{i ьEb$,lťڂ~1;zt?h4i5?%U>ߑ(i.m`JŐBdG8䉈LG @̼Q$ ~jP}'Tݽr s=؛l뻽4)e<ǘ[AT87UITW\s3J"C1U|"؜*pJj _$J,Gr)G$Hgsވd4[(Q/>ı;s7@2!Ӑc'gMz4_`̾_/cgz*(84^vk ,ʻg.| *!:ؑZbh㬨[\R OVDyn [ƳyEr"lw98ƶyGhZͰj px4ȳ!7l=/hE!dNcNњ$1a `߬1yxZcXpo+oH8\:6X$B+[ D ANr٘'x~<3ouxh!z0 1Ep c1 s/v M+]1HB(Εaz6I:ȴW W2  wwk2"{);RD'Ru/=Nҙ]™MqOmc;:`o ?' 8yuT$q v_)v|hߠTXC梀 ƪpԡ0ih%?wAREFW-B >J=(bgr&2f4w ?!4a%(WhALqUyKV] !YK A)CCV}*1 aG}\ƽ$E.{ͅ|"Vҗ*E$1&ġx¶뭋҆$O{"@9Wꃗglw]vaFQCz©n; KA!=DKf`'–}ѬkQܒ y(YN~ar0`A%n9 GoE}CXU/ܸlĭo19]kTĊτ!uMs4-iXWBJsX A[ls*a*RSWtuvj\ C eAY8vYK _+{]wYOe~.u,6-򞔝!h뤎~Aऐ)6Bhz "'9P*Qp9$dyrTwy_r۪)Ǽ"4Mgf"d+z WOij_&!S5$$pGSԓC8`:q\<^RPE&KcRBz9ᜦLFVB2.>n$(GJ2CڋGZO!VGǴnCUG:k4D8SGL4vuЊ{a/"K`QeE&*ڡOsށ].S!Rpz QS8i;A UG!R`lE.\@WnbFP{!iae }  ' K%an1c.+'ݻVKKD7#HpҚgf/'38Z>3`B!9Adkʪ?c7e-sEEP;qNQ[u Q0H7}3d7Tx$g/Q݈Ϥ:X<0\RųHO[)M:,QSAL{ < e.˞2"KPwǕߦǓ\+.r*a(%>٧2BBz?.AVqǁ ll8i$s8KőXDg0׍ϓkrbb3Z8 uN%|t*_n6zJ+vԘỵt򥡅|>#7Y(*fdS0/]dC\[{CfrJ`ԍ`gsݪ Ē&l$W%2xxK e7>|qui_ZO:byGYU ćw$qlT&,?)Y"a}'a)9#YY>5Ǣ}0BVϕ ȯQnk^jL8ts,T{XN&'8"$.3y`xJEqSxE)m-/Ko:_{}03qfm}Fd7'4#1 / b&`xp<ɭ̔^Q0Kq?^4,V! $[ ,V .DhS @ T_TM;[󿳤$TX'b: UQ-&/)Q躔x+ uC4ݛWt+iet#I$&4V G5ɝqHfJ#UKkF*LhmE%Α.1vQiL!Dy&AcOpzTL`fXLLLOM̆{ye uNN+wCtD7KMHFnB QgͰ :Y-1})UA.ě\0jÿ sHp@탙r뗕/Ւ֎oяL39&Jެ'IѾIПΣWDٖFI9LQ }~ՎrNTQN ګ}TL'vvmN7fvtYWEE.wfXp<ըv ) 'q{)}OH6uZKkN;#*"PFޢI&:3ʅžPm*fkꔨR6"m@Q: ~Dg1":8]R7[Pd^5`ɹ zH^2|V'kp~6bji>ww"[h!`A82ܧ5Oi;  X$&r.;9IuE~y 2 v|239z`~>. Yάtu!V+;cfxr |nx`ebAC7&$bߞQQhDjpd蓎 R:x9_:8D~sc1Dܩ31呸mBQ䡱<ńl7U!v>'jTDsSE8&<9uh 1nfhsXڬǽ "[zkTU4(u{CĹ+bΓ!GIJtΓ18Dže?| c+E P-)W?|Arx-S2 +_G;*";Q?CAzh)1to1d6լR 4iRNUm-q)HsI#oNsˡ%kd)凮 y7+ , ź\s -g_@(SL/e>2esRDQlڇ4mOnڀ*yhH߽_@Ak:!2C6Ľ4tCD1JT+sgylܡyN ZmivrPVdhTk #\LegrS'2.jJUSnR 90muuQ/Z,~ ڿ1q7^QhkPC켔ie p= c'9$ ̜*Ӵ\Ќ"%Qw$_^/9S(BY5S." U>ॸ$#JwtvkאAeeEyb1 ٳȻQ{a=n"EA\Hi|n_&@+RцUt< 詩ňg_x{gE2]!n37j GQudhKR4!21CW3=8l}Tz}T5:{:K:KA:U)nk yS"@u Ѭ {$?U"QlN*32[jmvytFևgvW|_k>+֓<㵐"?&jbߵl4NwfzJW:,7?Z!l&֖w[LKJ+Oec)@S5b}%=·'"n߸k%t2݀S/?cS^uu|R57Z }daک =zҨ!kr\q~U޲U)ڌZ=iS)*R!{a,hKb$Qm I95? ك, x|Si K?c!lke5pKH`Ѽמc%+?rPAIKYe:\ͭhm`@v$fYHǖOvLAqsW|7  {4,B.Zҫ ES®d;k7xόL 5Ӝ3UzW)TD3P;(DDdbvN=2P@,ȿq%'D Q>11a+;(u[lT !9ΰoqydl IyOdAR`CEXl ?U8SD ͱ D60oJ?;9?vY=qμR5wک;SSڦ6@~x;9_c ӄ+qP,w:eG3K-j;8)N¤KF0![Sц?M'6%[Ϻޤ@y/^QL),c),Ibk[V-6hqXk9 ÂHjDGw]rðTHYH!jC " T!HN(kԩݳ`d%!P+ +4vdJ'D6<-Ji0d|Ƥ 1@^`/j[h\"i'bv2}FZn8VţZ e`cp〆*ZDZ56mcÔXZ=A?IQpu2M40a J=BcBH@^vљS)79id8QV*υ)KvRo+$># (vj=3ܓ(L6A9lw,j&Hߒ|:tFeKoUsP$r˃6"^+>k+PLG*̋m^r8Ƶ$߳kI; "F+av+^uYUqȻ߾\vh\ki3> ٳw_xUT~pr7N6Np!PA _yqlm:[U R)KkjzU3&KN+;-hډABgUMԓELmaY/qn_jCLڙP$d~dvtyȣB0)' WΜN |dW3fd@zH 8:x<, !.im ھ&B44T|x%)Y<1tt{j,(Ι 6y Bk<7p Z,~v9SZhm@mgWcCʕCcٜ`V̲}z>{38"b>p!~i06`VAR0f5swDjHȈ0HG٭f5cuEO[U椶Wkxg ͻppz:}?p'˩ĔCT9Lģ&㪢\ EluU+G(BT^-{0hH$-v׊!|HK"iUC|Xm.d@dD>/%z܍ 鷩'=(KBRU}{Po]" 䂁7O e U_qkhlQc~] #w݇~=nHZ.s];ޓw(Kɮ0N!/@S2~7G5{az3p1̪{ rR=3ԃv~f`~s1x*ɔ:rSc O>uL/oH^;ݠ!7r<*qJ"5;S z9qE%[!>t4w Lǩα=^0 \o]}Xۃt # xM) s`1}x E8{'\7)IG.6!Řũ0s~CZwcgZ:kEWբuO,s8*KnՃ9.~.vҏFC~丸R P<,{ף/zHgZgZ5!*=%u% oZR,M>to|5i\=BO459@R  G1+1h3X8aω|>;x޷ D`RNn3T5(_5|3cCpÿpwƃ+d!>܃ٝ8+JǼA]߮T-(g M&FtƐiuamgV)Al C7HSy8;v&ߝc {uؕ7 Rݷf'v~S$T7q15.X 3]pVRBm;bG9c=E^'Hd7rS A$۾zÒ癍 XLGwλǣڡk*̭3˳ ueU( ,.J98d&j|-øc5ިFجSn%3&k `=&W/m@*$]{T>T́R:o9Nv(Q-l6$ũo;К M4w ڛB QCZ\P#^ϵ #ۢ"el"2"->ul5\߼}p/c++otzfvTu0y\vBEe[ K6jI/nBeп1`sX2}wbF܁:8%{&Pͮ%ibw'x)ak&Nx}C'b)\gW# AiL+&RL r YS\0Ӂa-OC*=2΄Ig+-H"1`9MUvZ]0>hYh8[4Ba#+:~2nW i3P Qlw1Bpz %8K}!' _^Q;?{9eKXX걉dM/~avy)sji`rSCa-?Zֶv5P%/yzH iuэqws_q_CH= 9/ L&d!Myy2dsc {v<BvwK^VzB(BT >M?jU֕#F4KxCЯU.60O4yX,!&}bVtMuwG଄?a4sVK u7ޟw݁e*k"Mw']rMyqŵ9rV.d?#ړe;/J9Q#ΕGX:,([Hl{ϸEEa!]/x?vDX† M;@*I3ׇN^c(w.mҊ.I:wpу a_!MGWZ׃c08)6fJxCq9*Sc [ۃ:mO~.kTpPkMM4 Na*joi+*]%qqq׹Kи_Wܡ>o҉ݱm7auOrCDaE<ו͖1yiRfYYNVCֿE"Ao\yE.Į^0OU =CcP"10$.;q!aF0ަ+zu_I;6^Wm9т2&7]S_+In5+ 8~=\IJn@1"e@Z3lD7DPW?cʱAdrYd;`P4yl*=ҥg91JͺTyT]b[wΠ!qCs`(ͱɥ>.=ocIDܠF}kQm})+ SQt~;AY4$w'2Sh x N(2P8[<'%&e/KPnLګׇ2G0;[͍ pٚ}ys-M9MxIk+6[BCTn_iZ([whbs {e+'P![%'qvT~*,ȫV=5TVzNJɸդh?^iİ&AO榑ow_W9Ate(ˤeu:h\E8v7zvpTB1BFz5ɷ5{^O 4@cu}hоa(ѻlP6J1=/3<ď,ˀ|8LY/t&[bW63}Տ jL{CJ΍."Ɔ;̚9ylh}vЋh+7/n!q`4$G~qH ݉2$ડ]gަ?_,5OA' .gg1r7@@4L ǰƴPR ޽Db~ӭ_~DQ{O^g`RBن䆶rz(SZ ZYWn%]SԊ*,+$w@w'5I\R/owGcGW42s3D/T3"I>ctPTKŇ,tTb$$]%&g*W@H-,VFo%i2lNrtL$Fyv.l/#ݲY[.+n.aR9:%oňnO rTQ"hu6J/\ap@w!A~GY A js9kݜg;VҌb4~Q[rTfp|M` mh3|qPlAavcNƆ訜p ݓ Y1XMzOGŝn'+iwD7B1H\P`/mV.&8@{Sv.޷Cĭ@\U* !\^]8}г=Z0ED\I 7{`Q:SZ h|׆x,(rAeBu-HbLh5_ea-&HJC n"]^3 JLJ^tN^i yk9Asb'= CMs΂~n|ԿR-f׫y+yhħO﨔 }pqKg$9E_b.9A]F}rɂ{gsdyf wI#IKk̉IT ϵ|ɡQ YA+U~Q+Lx=Tg&:q'Npk4ƀyQmnx=(w}:ĩCaXrؕ odZi9̥*u#ʽ: ޭtMnRVc۞M1/jEtt:3/Ϙ(0.oK,Ol7)8ǘB)06#_biSK6URaZ-y}ҷo)Bw7 ?7@Y;6Zb߬4Kl:p%;escOz6y~CF {  tf)04i4-O0-7$Ux ܠRo'ӻ(=GCH?`82L1g: #p 2#|d7TK,I˭fv NUu'qx=&aW+b#;gPiL<|#@ g@l i(Ce鄗1 3_fBhc;X_;3RS,ѵm0gմrZJq%FeWFP"U0c7YN<)=ܟ+ R<@S 5+%?7-C /]/Qjfڹz:!EHF+Cљ^ 9JTqKk,G=sLqbTH=Ȋi@݊]^눃)Ek!i;glo3՝qf~Fxƞ }2?F[lDZ8`uNFQ:+bY~y?K`l_[ ~fO`v_~n!O`Fk*–U i*w 7WЮ#fm21\L B!KݶF.PB=ۖGu@l88T%7X)RT 0XМnmO ,|gmvh9uG?K"<8$=]p:R{|  xj`ys/::K-lW5*VѰfax\Wz%䕳@I%GfgiaZӗvѥ w/- .&[ꑙ ϕ^ OpYQ|hjGC ¶;8 4#!0A7>ҸlV| {φcZ>_`r?k ”R_5$vG*V4(*Iw#jJ)@\tSu[E[FyO֓+iP(q?qp]nI:*fA=8LP1 K"<4}EzHs7GI|KĵmjA؂,hqT,XVqj^ȠT32zh#&'!ZL~'WWʍz"$h3F׀772/ `#Cs(@NDDZ$ !a aC0Y1XKȠ-%;*Y޽\y-bRh Y+vm#,Тr7 &'u3wU\YJ~Z2ny (@Fa&W8à/قvVQAJIpzƜ\*vU*.rP%c(DiԆ&M5~gL*N ;:oܷLM){JM?l#MOuaI3c C%S:Q3pV**Gp\ꏶٲSXc45GͪyW+ Y״H3.6LU)S>5-?1ދI@U9\ek#7NYjΏٹe ޣ.hnC)}9W4wIN'CLdʅsc*;W*N%ywٌb7Q[6ߜ=x6F!aL`'}9X#^؏wnS&|wݗAcg=1.~t{zfŨ_(gt49FݰCXz B-ߪ&.f8E,k ֜lz/xѱ,c祳;9SrgZC ^[XK6RzM@XCh4bޒ"[ p7v9gypC뎝~~fKw2jiL80'B w"Sƚ #ˏ ϤcmT~o AE7a3m uTXN/v땝rα*$|v Iơ;qfEIpjJ?< ٰЕLgrvI-;\Soiq7䨡ji\̚*u8.}ͳu]~MtN/r!Ę" Omtv,]79kK/YUhSsFJw-ExެdT3TǖfTkVBu m9(uCl:/ &jI3(B1>ذDA^ֵV4 ! gۿdK\@;G-I2A7^nm0^-q0pSNT x%G46C|`#8 `}SϚ_aܪCeD X W50ӘM!r?K RW(EkyP͚ ƞc9zWco2aq\Js؟;Z.Rif]gx6w `ᡑ3=dj12=[u3D(ss$ $+YJ߰ikib"k щXk9I(p lUPdu6IRA-w0K%+1 ;s9w?SaJF<qBl|u x~F6,th({Hz,|;pSR=%k(+Ė&;F7ʄex9L >S5ZL[+06q/ndR}e9}L"WL z19{m.#iLBʘd-P= $1}TL|2J/*Q(PBـP4*`m.Z.`pտͼ-wOUS.;hX"5 +Y+Ɠ sͪ/;3#hL޲iHf,sk]\~|gW'F3k6)nrUȅ:2qNGa;ʯqQp Xd ]\?ʄx댩c)B5AtjZ!!} SL+3`#iCp3XZ'֌話+?~Xv?B4TJaf^dl "NNժ2m atFh=Ec4}᧰X85 (is.&:m]m mlZvcxҲ#uӵv8ҾPƊNN2+OÃ\ 2c5[!`jo=U12E`Q/D&]OhդVO _;zqCzRh= !UcKj9(l*0~ l7v#YgDnAd CӪNc! dkO EµىF]Z69]1Dzy(u爸qD{ٰQ7Maة"6IpHx-e vL i\V]}00K_u"v|Bp f۟b?|ӭ#u)@Mg= jh' 蹢$Z╽n[rlO 8ѹ]R`,468k>\149P"A|s1v0݅vGퟃ]$Qsx!XDY?iˠQ`Fu-VJR5iKHk8Oh'k$,Do/Jf^zUn7"+@XyTAX2`Y92BfbwY bj$.idEb*hZc+\^?IG5g)GID7_u.e_l<c=OoR.O%}ܵ,\;JW="qy=-[Դxw5 w5h/^ eX<1R!QûEeϥ L1b]A(NpefCj; ~823ΑH5;9#iGesbl iY̼ ]5F&}AȞC$,;ɽ!FNqa,ꏜJt c8d+3޷VظVL9J܈ ڵX:Ee8JFeN0`b pJ SzQ'T=F(-]LEmq{\|D̕y~ӸetZWhn q)Z3/'s~2zc0ƔS }<Q%=52WoY7(&bѬ|cCkᮚ>ɲ- tǃ5@'/r)F߮b"pςB-b [.=s_X\X7}4Z/SF.^ЀÍ wn|v5kv03W_l=ϜA͒=v=y`ӂ_& p9 MlhS=*#Mn%8ܡG1AAzOӈ8+B ~8;=쏆j z6R;}Ur^yAX>5I)9zdlgl:ct@_X&{/=B:?3($x+P{t`7[v/1d-]25^ʨ3A+ oFj Em*$\GMsq*Ҡ}0'6_31ʚG c^lxٵy:-$vom zqZ ^ihg֩1)&Reo L. %CcjݴY% 'R9 鏻Φ3⊪ K[X)g ?1c9"9d<n|xKo\1≺ѩt2@SӯX _Y>sumϒcY-\wKg9:km$Q5F%%iuPY74;{p56~ܢ 5 D{.i8וֹ^ew54E-ȨkAV(8OiZ e5/0/1CiJK \6.Ffo6k L6il%k1WK5BaaMb*/%'m]fhlr~M*~"@ uͬ1<'g E?H{DG[ U3ļMsM⭂o4lx;rJ 1T3B&=RJ6桐DKʮRC֨Y HCԹQ^V}v.'|B†"iU?Ħr:%OWB'߶ !d*!{&7ctݦ;2'.=JDq^P7υĆdjp,4I&Ϛ(L ۦ=]22[nMq^ ӜOA!IunV3n'ЃǕUWAWyd?C谥cky"+V pbP5MM`]Ӭ¤M^ŃE|B`|br|OAGUD~aDMixɋY[W>zV@#vOujDT&TG!B |Z͛M렩cuVSmuSa B w0 uH 8(@؁o7WϦ v=b210I #gsrz|--P -~Qk]S5vutc`!H ›#=CjK5o Χa@r'0YjƉz%z̪F&r-t k3zDcjK*[I`tYm@;Jhĵ'^*z@)\wp0Qy=,8VY2[(5D7Y~KM%SW[%ںɏ[+ [+zXޮE$k̢䀝dP&s%շ#E=e1< -^7FdE q({<<'7N5+!Ps쭏4 {b:#ݺ(5loXeJ7MT0%-Gv#Dktg;Ԟ՘4ECV\c K'G6F9h $$.UYP^~!MYZ^+bC%`'gCDR:?)AVJ%Vpq#37W_wŁ/29v6=;^9SQ-z()>*q%':dL4AhۀI;[_[p('KJ[XDh%1Mhȷ1n4Qc//uib[Ϭ>j%w݈e/lqS OEQ:vЉ3Mk~;6E a3ʈAРzu-Ӟ R6A1J\@ ϱiX|gx``ԛ ^YyD>o> |:1`s(%|#PoK|<_p. +$PȑٰU<2J.AU\|,j^mgڥ9*̚Mp'{GBY|Q&%ݻ݆K'ݛQH7bN.1䣌#wPC&M>W_P_sAP:I )[L$.vO6baGN\h7],Zyho % gh3&>  Rri*u]wn9*ƭL##|BW`λ:{ꡂEtl'PH'L{HYb2^*M޲\a궊9Y٫}N,%Y:C+/z $GRmj/bä1K c%P}*z,6Bgl kY`[ ɨoXAuoI`o WŠ70FF(0Dt6#)/e^dr'a8sQrR.@S7V0sNbI {[nsM9B̞+! t0!wrVx$j{vP-wG'~.:D@VxkW@oēo]4"ѡC:|7nTK} gu>yί%5Al-?hmf.\xm <>E7`sqK-z:&wXJu9+p9X4%O F(Y5V3]CF㥻D*Tt/Xrn^MZpc*7ȿxX=-c^2.-'':kiBAgޫz cr{s[6/aCcu:\.ܴ'@ɽFh G˗ ΔUq4+$7LGuW#=WVQ?lK-p?05;5x@%\o[%0X#q+fK6yNRZKJ<9 T_q ?@B@D2bEa+nl 0墨aY{IќeԀvcþx6(gRBev+B42|Ts'($wqtE(ZtR}T8 XW;0Dۄ8t܄?ꃮhtڳں]¾E~4]RH"P:qP¨X "I(aŒdSMo-?79?9=A1p&ɾ pQyL45]u"\LIScS95vԖomI(T׈2 A$tQ "-Fp,/9G.Ro!p* Hmq9N': toTv3My^!F>4Ε,;qHr,k#L\%7d`x6ʏ ҵ&\[LK6 $Z&Yv5Sb\jbP\mt(V>ہz*-()#0zYҢqc{cƣڹZblGX1migv)Y(XjjQ,~kxQSaIG;sHB/7w6z)Qޯ B#֬tc yY~BZx̿)cmz}Q_K,ޔNIv[T7T&p(I kv oܿ{e72/tةp`S"RAA/&̓AUڨAC%e}N80J`k$NjF!8qpЇITո%~ͥJߊ]5aNGo~ۗg8J1ب~U٦|pyt; )MHvZZֈSHd!J9& }ǑA2K;⨫!\V)Vu-L8Eظ*ny1`ϵ)Q> 8d~g@$υd8SݎI1 z}ÎuCdxڪi-ͧRDHGU :,w.26K>x3:{ԭxbbNlA!;)p?Zyڪ9!6di.~Ǐ VG~`vgЖ;bN03UbLJSJE.V6ZK< (M<;,Akp=`qpkJcʎ$uX i#:kzf]yH|BHq99Z' 41sw/(Stm>a(⢦.$^IUO>(X]F yas'{`˃I^n5r?ޕc`L|FߖL`(jy6 ,6K`Ќ<.ÚlOAjڲת9ǜ3s55m:6ypRR [[Z~\2H8%5zs( (҆O|.O"Ha8Qy} $[ {?uO,{}=٣fH\S N_vT#[ tp6[<#r;W#@H*oB6'KNd= tY+FBTHydP1h"Ry5;޸a/Ssr6#!2üy@g6qO6}MX8J!Le:k" q]!fEmw\*5~K߻v^Fbcw^Tcun-Z9F{]fN[-Bc9fR`h ; z*5ȴ{8{:#:P=[urk@^ 1ŸM-}am\P37ZC=' Hݑ-)DyR)Wj Ueaicݺf0G?O"9_9gG/1.>Ʌ~2QY&,R3t,,>3 Ob1@9KsEs.([JyZO`Ї1۟"nBIEK x#R92JsDf+Y0 *E4IoqZ$J6(N_ c{!;B\@i~FL50 2Vk E#?܆N}!,C0Fvm3& 4+(LEu2Y"rw%{*5k]v3.GkS4  <4YIՓh詾#QB,;GffE l79ELS`;PV P[B &]UTDLM}^S~zO:kz8okk_J&ű(J9-:1ZxVU!e4Y`f&GNAX>P+uTy`#=@r^Ė©Q^Z}}]X߿fCmPe25W݌bZ&\o懖nKMNmt,*dINoK]z.`%+Or$q3Ys0eswl0c>63ٛlw+ }tzP0$舎S.pg ;u8s:ʑߛZ$&6Vj[^o\o]4ty7+\eQogTԥ]f+dq}k_%vPI^O8؄S˝.gwJځV&KM@?Z53li^)SxqRsAxC?/QF(پѾB=Ca} A|@ IJsr4a"s3y|HPV#q$'{מxlݞ7=͝'Sao ˕ ьMxm,vcGгB w tʸ)ӅC'z$fAP([&8"3wfo͓;~e7yX/n:GЏMnR.x IH71ra_9Zω gʒu;/ 0sL=cR\oyU쭼 bԺT64#K'/L;>_]TWL[?1t4FśQD&2*:9Mi8Vv-m˜:+IPHי7sC9yl#P=b9 P4f>Eq<& 頽ļ7U46*vmbZ1}u(&D~\Pv@|e)t܋&Az-[䧷oY4sL{yF{\.JX;4dSqJ,2KZX?LS$GbكyW<eCf%{;k ʥɱhZF ^FPFIQF),k3D| a9q; dI<- YErUiAd>2ž~e19,V"6-ic6M[9R/b(4l*bR`YcrqZZog[FΕ57Z"WߴQe2uCZZc.,Q"&kղKwEveC#mm|uNr}t3qPeǡ/ a;!<)){Z7i&&vxUWjGe$id#u.\;%' =1%hY4s j\+ѕ3bb惇GKZHүWٸ 9_w+ѩ0:N6*jL!ݖ%P^Sg1BB)Ze();| rq_BsP.>h\,ڥ (H!I( @$5 N:hܑ0+SʘѬQ5[iѮd0U}\r~<9Cؙ4\y?Xu㖪0a? ;ٌ*mQ@f W{Uiy_zDox'ķ^ë1Ʌ(ةUz(F-ʣ IDYr0`}E";GKihn5t&JN7{"76=/ =9.2@< ^ k~v \r{8/Ψ㠲+PͿY 4sYoN[)Z8}y{ Ia5qǸti3@W'ҋg΅PF1h7 U:u\ BמCt IѪk;M­kСb/$_ѦtR/r*NqL;ͪ+Ѹ;Fs=jƏFf v{.vmRrA t BZ< l-[[sbk1F-tqgpm9rImz1i|:G9/iߍ_Yx_ \b4>ط c)9kXCZ3 t -1!l,b@ԝQVTeAD|1n )ﲠ z/jikJg_IƻPuU5vP**I%eTmiveם H`^ P3BAʙ8KXLd" pa#|)IkT1wæ}_ߊdYhm,bݦ:)4U\,'(ȇ4sîx.˨&l:r@8Yo8/p0+{2_3rXQn@I`/ŦUUكzFn.$Dl< "4Q_FDB7@"j?Vce3Z.Ҽ'?9wmpXN8 ØRv.7 ۜmx]/|$p8Oo7"\'C `:^mi/6F!cJxTkneBAX]^ nѦ3_?2q||뜇MoBp :vePG ݸSLA5|@;We]T8wdul(㌰0ƀw.ߘpg1Cǹg=EJ_{*,cSolLqXG\+D +C:LtCܸjc}27A![seItoj*)iS7?D)ft1$*\$ѐKc$F+.܇NƯq0I҅))Cd|Q0͛:uҦʼ_;F8cK\Akq(9k~S?ey tr2 _[/a^PE yڍ=.4di1JXF1M?zgw2em= GjG2[SU!y޿|3՞؇gqxZZr~bu}Ft:tt&:{[ g&JAOB/2е=rT6593Ak2ܡ]yoKMK۸xtŎq%M]s~ew?kl3L-sFQ vg}* B&g)Q=L¡&%+WÜ}1V`lI/8JhHl!4LG𒓢xlfzQ!ЉʵĔoe~#yjϥ6Fq1gIg 5s~vAtz\8q *r'$|0QxOȌÀErx#19e?ɒpr/v[Js鶵(AtMnǡ;YSK7콴u4;AΓ! uȉH <=DR]%WݻT#(C"F!AG^Ha1(6YXƠ,flQ rSO!0>w j:bdiYОMjzcsi‘wH>QsQy"0K(pJIR w!&4=6k01bWVϏT:4] 1CWV{/OֹL{}\{ҕ#UՄ=UAa_ϴt{Apk&M]V]#!^ ٜ G=1i/n " b9{&@skjjN c0y`Ȕ=/ JR=VA%k1TBEa(%މ@8N0rt$[ ly(v~$-f }ZY*mol0<=xdI%u§V*S>0OђXY(S:) "ꦙ G!2WGS@᫫sƟzmcuU"f,,Seܼ*@$ST;RE~MiN "pTib{^yZV NaM uZ|+R{DVbi4N;Iei=`[aeu͝{E3~9&Rv"10c=⊩(.!VK<[U.ԭݙiCg 1 $su7ž,sTBU,3 7lR93u;4 L%K^)Zbݧ$ԐHleͺuP bJSUpaKY5\L8 e*{,з[K TKXgPP>:9INE/yibQ F,:IIp`(nMejCloto܅p K{\cZ%2"1q㘙[pyXˢ c'·YFu@Ε0C0 'Z8 kC>@QVo|j!kqʱK GDGgg4Rƥ3xכo<364Julpuƒ/wJ.o.zwrkV~࠳JAF/mRußT-UM#eY@*&>g /na@s1NxX( W Z›E/Ϡ@UDx Axߗ; v?t*1٫CЕ qa!s߿ ?^5X?jZ8VK7w%EN~Xo֣{0<(?n|赝2l1U& Aj so~|Rz :`hUCF(l |tA$ 9:Φl񆫈0i a4PӠ)̍"3Cn"e?> j\,4CwkihaEH9o@![De^̌QSDn+i̶%\,XgQUi)SaGQ_ЎWU9,TŴ(biCoők89]JwX'1 [xy@+4KR#-C_⃕rX@F[D23F?,߆qjgq`{Ŝ+6P5,lChs{X[uPDNfYyT\1ݳz+׳SfKr,S:qĤEJp8ڦ%`%DD,̓\yCZK z:?}@&kcpU&uJ6ݛ_9 v:r覿p-=dRet)<@{'׏v$Ӈ_ߎ&-$C"8pX‹5(QGo=P.iou[x4P?:q 3gq4qQJرKuboѼwuE~WJ5pkϴ,^vL*|ti[;3WtJG[?Ѽjе{:szׄ͐Um o U79 sHFEbAq s|>0|ܱLp|[(spo =I:[D |w,~=0"4F7 U_w*[ւmS>S>\4tOtFCy̥$qZl^M8L1ChW-1vg'$pz֝tu7Si; rTN(j5[v~"=(z`:oC\Hů˳%ԥMuյP+.ϖ4[F6Oْb{7M}X_" K@,5 8B_cPHP:D_ۉ^V%[z\L!]< !t]Is#aWRfN2El$Z⏮n@vkb1͏L Jw6d\L&9̍I>[aըA$v54R`aMsͯL1SZH"ewb~X<8=4ߋ?Ho@I5>:YҚu~ Q`ۮrA=2l^|=c-ҦW7zl*yf3_-UZBrtimSa77>mLOI4(㊾A:z?럀/™w}Es>ͼEזV&-Ofǩoov&Ue{>*,V"*?~ ow;+nG߻H8+^lENhz98Z1z=/ 7`bbRF|#~%H}, Ά,6#⛴+^tY&tr5KʮYLRpQ6d’d6N~ :]ֆ+"ڮ!k<] 8ݦֲoa* J%O |E%ʃ+/x/hPNZt3cڳ`doxU#׻ߝMc^]onth|կ΢,96hvU谂3 X$Z0z '2J0qqJ 03d^b]) Dq9 8ѡ4lh-؋ 2mU.QTMDC8Ik ڐ tT7rKǖ oor+$SC;!3,bdmJLd;T"\5\ص3. !&HIb2ZIrWB؆zPM%x|%,gBw!O^L7#ȂPi7aC74Ԟ[ᓽGPɯ_W`#W9K4VZ̯ h'yh` לEei) ^x) L^-96pߧ T~0 ~`m/<RJfK#aԙ{~6H9of w,ӅO] 5(4'8DН9i׬d)[&Z *Źֶ?4dʥP5%_ØZ_ywuq]i_E\vԏâY+bS,qeP]95, ZṌ3TJ,Htw\TO5g|)Qx@9'JC1C03 ϲ έVP]1zn/BH\/,+{\&nĆEU@=m_N[w]٨!t1##^T>C6V`gtCI-bڣg>3i).]>+.ȍyj$*z5er]m,71+>ޭw;sԏ۹ 8[Ty45-Ii,7SN?lOg3pܰ ~WdѫaN9C((v+BaDw[!1- ^J:Cݬ* 3z E!GM>/XWsաO6VPsE(94ZjٖQ>Mp7]ܜBhҫEm c w¯-|[p4#zdVPʵc#.MME&+AˣG:% NĢd+hrǷ ¸k_=4%LβRd!̵ X- [xkaI]XhU%/L8Q|k fݍ|m-:xCp](O͹t]=͛ݛuoJPϕV@CɢRPBXx->Wi}yU p `Չg/If#mw9&Sj?(#{3 ;ڣ>D_m^Uثځ;\F+5d/V {QKRU%s1ii*=TM(d! ,N6hJL"$ftP `:{6p?ʫeIr+BoJS1=FtDd̙KUR%H0LN]5wZ #߉r~{s# Iam0L>d΅sc/T#_M"8Yp;r\)*y򟊈jfF iwE=6fB>Tݩ㎛g(Of \Pdݼd4~^eM\:ayTze>誘 WJCsaq@ҧqB%\ pt"9t%2[\ 5xlK=K:yX^cVP)Jœ﮼2E[zmNKNO%3xW~:F44i57L挍9&I~8ٝ8>#9J:FvNک#e{P'I/S/ԩJeN<3'g/(1jX~%Ghu|oYFԹ*7 (+qVYDzbNrsteԮiVoY"Yx4`)5_i ŽZFlq{Th8/wKIzrZ+B^iZ|+bum%7ǀhӊıՑ/)Hٸj6PxxN#_sbR+N,7o ~{De _\`CJJցLL=4Ɗu@Cǰh q??n >[1qي5m~7dϏۂ,nzam^tm=mȞl=`ߊˆ*mp௏ @RP1< X }Ǟ^5*'֔Yޝ&o:&Ԫ$&C)fL솀aQ5p(9.څϝEBpn~Wܷl/s) ] u>fh0 I*dn_}" R!SIF$a)q_qH>!K;j w4'+{[q_VL*l ~.uT2DRі僥rr9*OۂSw32?n fp믗*ABT¾~TEmŁxTF Z/Xeߑ /F /vD缆(t"'V T+<=Z"١㊬i "p%"PPST"+}" 4#MtVdդV!2Ab!2Kp.O۴uw)3-EV\6ߔ&KgWdG;IeLracv(r\aRQ.ҐUA32KF8x49(7,oyYTT}\4D1 !0\U@wt=MXzƀkS6mTB oQiN#Y m+iWk'Ue6K>~R/t̩ zeih"\{>$;hqѶN%{3/ x،Պ)1 m LA\ !j2 uuش BJuR:~<#QIY*FYZp0C*A-7{SQ[eMFeev%gFu azո8L {׊9o5MtV⒓% ͛BJuTǘEp͆JCYsrCT"1T,8.bo|8ZiqF(p%yuLn[u*$5̔N&L zfM.` B&9K[}-Y~QFj\@2Kpj\cdQF_+kv_IoT?˘x3Gcy>lqEu nMX',mN.<"!Y+?ܶ*zj`O|i!veXPazSrxv2I ma> F(^PAtnkLЂddA;_)זc̅frd#Y.(kcۘ *{#`Z6V2Hm6VF֝=E@aC+ǔ%=^ON|~RpY;B&{GwF[Š.s~oE{4ti§?(/d(sc3r&3!TGS8^bMI Xr\\-8*be{Dij7#@!iS1%DxTXHXG3ŏY8J-.?ˍSib ʸ4[w3NMg׋Mu` h#,׋nY;~Hl-]4"/>%0@(<*_3qH!(mu>wKK< lQ\ -1B%ݝowȝ,hƘi$O52B|S7Q"zj&%U6|lC1%L %sDɑQNv(Z b nH~1MR𶓦 * [G vgQJ*aao:ʢRʂr8 THviݐ- rC*xQ@:rZfhLo3oFj3p3) w: Up{u0M=4>Nm.@&p&ؒQfҎ9ߦ~xp'| ΚK18kzI׫ygn<\pUyYڹs.P MK`Y9?KE~+R?W121?0,Vtފp[;3/LK爕/UC1Xq3^Xy}*#wD\` et&|QF2[ bXwV] b+j*P"vط;qQ5G泩;a[gvEGd!X Ie)lkGI/_F/>)ߏgVv}N5!_DGwz<7K`2:x{ّtz؅?t+dIV1wG@TUh<ͩ =ij5/ЛTt :mU}^'݃S`G1J xwʖNN샀% V*!PL㮤}KO.[ae#j,T8gciRywRΠMF'YHDTf['ų ?G2N5J@ 򇐙=misഢ*dZI"j\uSw "8pB,i2Å%{ HW Q.Hֳ}%J,k/wWU=`ZZ_e8 \%JMih,]bX  />+F%Mp'G0Su.;Nh)RV}$O6X^FOخ߲݆,6k+O`_:4K^N Jn"("?{k?33..,vIWv_?֫eG+ܣ.= RRV2KHF0xfcp(-[8KtݖTx4kD<%Z}32uLeB hOgR7JWi+~:1G~ ?qQ/G!Ѣ >B>uO7+B9yN݀&oIč(hE/);nꎛz&s0~q1F* )rzG{A99͑ uCNINݠ3X䤉l 9=9u7M ӈi**;*J[@%مba@FEQ.bQἫQV)%,f\(Y2uGb36j}3+T %)CV΋H4C\X!Me泞n+e[&hJє<AU6YᜓP=9L0M(.l.Kw(U\|0XT],d4k /=*.9#Gs]n RȧY k([9FÐ `3gQ3Ga[Ĉ'TjzR#OH'-^ 1r,0b `IDXĆIf7vFPe/ʙOk!,- +WWWً(=FW6 ^3uN^m95Y2P~0N+̯b;б CP9vT͖kQǡĴ~һ 78>%,3Ί^@OH^]}â34Jb?x2!f+hxM=X7HV"]%hNzV vL.L_bAt;H YA+*gZ !;2:c Ƹ웦WLl J9V>āBvVX :+),6*/ j SߣYk h䆛 !?~{뗚~y]+A%)Qwput?~#ӅҗP,@3U>"xfŒ{ (: 9Rhx+fh\0[_1M@ɽݧYKljPK8kiK GoNu<0V ɶ ~cKS w\'pqu}߄*Hs1W8(_=OZaPV +YLRIC*dIXUh]~>թJꪴqjo@^@VO ;RefoWFiQ!9;DH&D]jZ18(a9MCסKyȚl_p(A5kinU.n)G{Q5/[Ϳ: HѵV~?:i+WS'R2eSWuX3k6duMMh`Y/B,HWVKOiBQbEzKk\7H@kkGXׯ'pɲp1*e2nh.>#h(f&Y3iw2+t KyثzX3u6]ҙ2c֬>#'X7U ZvV#$jUmV5|9fNN;hǝ`F/F<8]O#ΖADM(lj۸ fcI^FܸJ!wjMg$Ud <6(AmxNV7R%˂kh#$c\0ڑFoojQo'PXBG]W4z_ib=Iՙ6 :J] |!ٳƸ*ǃW@Ժ_2XjH ܂[  -Ac|pj{WZTco߀[V]عYZnK(b28%o5sPGyt`ǔ`R}k%Pwbđ'9y#)Keo5u;LO?] _0WXWK5+A |ojD($Οl %zZF:Co+vl} cTy@i7 9v]q>ٺ@5>5_wY0Oj8^#9PN4]+8dŞEUE 4tS;kX9 Y:k*n5@%Ac}u-ZMՊ6B8Z0 jCv*ͥCi i)*{?,PgV%j{>&tGfݴBu C&lQTQ{$b[7PPܝʴ(vѶ Ѡ\RnCPơ m58gu˄v'cG@Ewf*ID?ljxH]8hV~"u&utP=E lELTbjߧﭨCJ,T5~P&O}4ۑJ^fVTʋ 77{qM{jZa> $۬se{d3SlWC @RFaIctͧn[ש "T(if$tB0NY$0pC#gk/T K8 $t<>7:q ԋ ߱ (^y @aicװ ny_0.E8a7}Gp `Oxi\L[\t{!⽛ؖU-}Om Ac u 5P#ҦÝRaX4YA݅rwQزeFBWΗ~Сw[!7bhC3 -iYI[e It'I8(Zwn`0:!sǔdI d9ƾDig?=!#g%rDXn, /[]k rERNL@!0*!H{t2B?`` >L|LBZdynW<;G Ҍ[cfo0HU?/*anW#BP!`Qzƾd"x"|3HA Elՙev8(_pRJGu9[fp y1" 8FRhC2`,B-~Vp4~s\CȽE}gNNji •f,7UE͹XI撅uo{ %zF"}o4)eLC(ې@;wV ײ,`>|PcuNV^Tqz0h`L.~3mVfxDdmt:b2Upum9Y J*јR`/v  iv cxKO"7Fq$ P~ "-1'g4(yio] 0<]0 r ڦVEGTi{)Z(gOrشkuU'0ԒYk\];~E6}jRBD6KeI+gĻݖ-X@.qZ*Ģ8L7P9lqw$><&i݀Mߜ5_I|T@d4(^y|]rK!X]M_&gY튽ѐ#*qnsJZNzӕy URИl7rdk!j^"Qb'P9M=aT,-j25DPkO37J"}&,%Ú4.t@|Gmw1 ӝĄR-^&ޗausz2Smu#GPU9S+>>탧z~oe%ړ0c\Ub:3VhRO1+7z"2cࠇϒ(k5Gr'9"̘p˵^u<Ȗ$NQuS_Rn]/tRהlBn;]T{L$]bQU;|XsGxmhvUrChQMA*m_Q94)/r.-34NlZ9]^FflB;t$U˔ʠ|Xb/ST/g$w TzaBT6E71wZ"Bgr̩Z(\SjPKka e /eHE4H#o/حo&פ4^P~BXJsejՊ jzhMB|G'!>2rŪd>Z9#YNyg=)}~H%-6^.U,b{*bNҬ#Y~W +k^btbS<wm&#0$dZ# ,WBb!z()!K8QlM̆{Kg& V DkF,{]Gb8c\2!@e(],]-E{*+D!Ɲo}_O|>+ުJPkٝd-EA=@4!hT~" iJK.GG qPaϴct Hg'6|꼣۱ŮI64{hKq-(/麽YZ0 I7O!ɠQUSkEb"c_֫%Gyր³oE{f)=efwMU$R`^oy])!tH,k#1>6|Ʒl=Q *1s5̦JtXL~TƹfK"J~LEBFk`Bj0[H}PM,s)54ssKO2s Il@V:Ti@~_/ /{Bٶ<\_:H:)PM4BORt>'R&BK%v*y&/{x^+k-8ӓuҰtcz(X-LʮJДmQa$,!E8)B&NzV[N 'ʮO\0-9l4K9rFۘO}=lzひ+IqjɷR}ٞJ] 3ܒU9#%jSO>hP>C4'P$~s 0yD|wMUN'|"}¥Dϥps9P ?Wծӣ7..zg‡\(m'>=tSyoi'|=U(Vњk7Fk2biQ_;):tFmZ9OUgވ@jF0\seuXUf KݢhlѠBUMt Zy{a-z{3OFY4")Y`:HIfR0a)vIK7G NSK5;W(ݭb=83J%۾+{}<H6V+g CHo\`ZkW V+or6X~`q/ )1zYtD~Pr*잞T%L"ls]2'汚|D~^ u/ %zfLWi7p7kU4)b0?H 3;N_Z.I(՗.|wk]% ^[ʉ@D ҿͦ;cj@Oʶ}AQIlLoc\‡?r 3>gGJ(Et9|e1`BNYPSW4:K5KgVy@_|^uqz;nJT)Yeu1w]LY ر p϶LJk͕__9^V\aB:WjO0)鲲ڛih#@0wUP;33z.!y}5 d\lXi[:ez90y|vcn471+uբS$5w"vA79/_Lunw05ZOŦ>ů. }|vܣc@y<?{{UilaX000@6E>&hQݯI_"U:|k@HlLf`Α)]M5Gž]Ip6Oe]Wܷob_bу7/3 IqW[|04?}JX݇f3"k*:xޮ+N)q6:%N]W&:aJϡj'!߮+g;yg o-T4sS֨ P{{^;nLx{o=>bY`xV7~fO0WV)|?\G}U<*Y)lp#tlUN _;jW`/*ܨuɪ&FV˴d YT:#,p-l a00lc@0lfmUgO&m!2OR lhn3!Fa$dq=}LzKd?>ȹWt9~2vG`QUnic2n߫MXߤKw |Pŧj{uԽ#!O6tSU1UG{.~*_ؘF\Йŷ4ΙFO&[Y^*\7@ qLVO,IՀ+",0?U}q*=K6iEot~VҠg΋Pq-pDPرT9p $p ͛R4/XrH~(F I:2%Fv+Ά* 3r}0h̷._q~o%.9mg\H58Fz)h4Ũ ]H </-򭮽#n==U^V48E|Lxs ]*8To{Ijh9ԛL(!L?\tXϒBA);lM;,.ځi )5eEHBGNiY:57r>mk"?H2;cCHc{<~hqT-.Fb>BB{> }صA i̠aEuLbD n*'ARM(ĺ̼Hfe80T>ZM &~ղrKQWBN/_3rr]"4>a-)V6ti-@_^#qQ5 gX+{(_E*P; gZ{gTάI pyl!B&DFVZXE)$ЇWH÷hTA!Iqy(KZVy0ccRc5iXכhOJ ~ʭ XݨFy-}paNZ=-i#6Ei)=]5ɍu JTXV% 籴w+Z} ze ÔE8āҔ+hTJcA覱B+JK&& 4V=I#qԩdšTGh&Q }AQCƞ*jGu@eUS+;kޥ9r*r){9ym.G)L68N7r-Cǚ!}+I05C-"V#wb^h3YNNMc?t9h>uU]eGW7!FoX(${wI##)f cOξPG:QR|pzCW384ȣV| Йδʡ.}w7ڈ&Mj~|jG>chԈiBC۠Yv8Xsbܛ-E(GʪTVSV)9*IayE}'P{2#(\u2Ӷ, WqRY}yg#l`PU~p`P q5y ᛒVJ)(DC{f#12"*-Z?UN2]ujm3/^%u.j4 jcR 526`RhĀ'Z~DA_UOV,91Ԗ ͸Nr2oR^@gŐkиq؀(4Kr>w6؄Λ 0̝VP7aMq jsE' vx"yU084Zpq`и)/ r(03Yf Q;,Xoi4:5ԣ0rt5blJ 7ݚ#dҬIRFwCCٛb+qAC r?i @_t(b#B $ӕXXIHKbOIn:| y>MG qd#KpO$w-tč䠮^Ƹ-]nGn$6i59@:~~'TsBlC [[;2 :TfUp@^[ >jutoABxE;ve}䲜S" >@PݷU&1ݺϳ״cNCt _T^c,/J-:$W^,(Ga6:^X{`+b0O]Pg)=VŤD~W~=C]n6YHib]1@\ y [wW=>VUK?V @4~ʭPm灠I6I`kUi `8n`J8$Pkq2;|dvlzp4pճirI8$kWY7-aۅ` dgy^nu{5Y }aN׭5Ne-=G BUy{I{TWOB!^ r17l$4?X4;QK_"YGԀQB90!~}/K!FC)*3c'%x٩o ,Pw_ I`x)Bh isk?Sۡ(ui_g>ampMU`J@KEUQFZ %<=d%FNy(X%dS\k(>/KuzS? %Sff/d۳& #L:‚dRR+ c]@gn͍n7Oz\ߙYԜ)?6f}G Dy.jƗ";4yufA%l @xmYr ZM@ojZNr`+>Pt [P|̅ohۺ&t[M}}.z4\Ω99@hc\wlRԥtu {9po;Ga٦Cb_wݦ =SLMÒif|iSaKA#u|Kx_-II+Q=yOg"m6["d@67놅3R.Gq"3}f؜\܌\3>;qO=>@EV>Lz7Zp'ۑ?ղ#Gn=[|W?`$,@FD&XӲQ%LfFFvMWyT?=5AUIW%]F;6`nE֮PnZV/:©f@:~4gmW^URb&)pI U۳ۉ5[LP? ): W%),Vo⫝y#62A˧ms7/dnrդ_B3Zh,SmGc={{Ng 5ܐ" InI yI # ϰk\Ns\AGkbIچac6W~Q^3Uz\+o@/S$vdÞ j=ɝ_9Qi-fuswY+S{?&sݭ=_]j2֣a_24a\.ċ3ՙx gXn=]>/!wVKP:,:Xwm(۰ġ"Nr\Pb)" OvE <}4*ڊurOcl.ıd֌_&Z˹WzX7)5铅6p0 {/1wsf(Y~f obG%E9)i F//1Xlnu[ TJȕ T4 #Ln{lt2F/ޭoO>-5Jm9a=X5Cԡ]Q$(Q߷W:JJk۰/q<.S>l$^>Q9pP1FcueF@o])}~C4¾[ AqpYJQ^Bե=W7%6:x_RDfA™"4o]ɕNiĽ ie֘yƼ]WD`+Wi"oڤg qx%{W#}]WlE,R kosЮnw4YG ^+ (ҏuEy4"~*8x:^^*f5/1.Łp-i p#UTV _*e6M- NYvG37 CJ~/ۛosqM ~IYmftffBmfGĿE|l~9C'Z 7 >b8+pIyBkm0ur\q>nMUO2J b~/Ѽ #S-ҩaLe]IiK=#AҼ61v N )jW 7 a>ĎI>RT7+9eJ9<_Ӛ=`X~<YL9%W=~QϾ`˟\ղ5-h;U"pӪ"lHTh_ngfefh ,h^%lw`h IvcRAp@`m6b]6k_$ӐnN'Lg}ㅉoJ%i1GD.zՌН@˦G}K~ǵEp$-O`k._r1D$kx/Z$i5wh'|TrstLPa3ΠzE;ZUKTO:?GԽ|,C4LNݪE3|i=7Mz|Ym32ͅ!QyI'>tlT-ӞSmR}Z9oY!Q+RD)v3>B4Κ3/Z\Uq$-z:@ta 28HE,~ŚeWy"K B+q{*r(zN;Yr~&mw{IP-&g_EǴdPCoZ8WL*f0[LzΪ3VW(]3Q 3jk/W_#Ѻ==$bIǑ4լ05k%o;uJ&0Df$PFMʘԪt+7eeBN4v_}bWՌp0>u" X>!e$z[?W BO&Q^-٭:l+ـϑD֓i{r9N7I@k ܅k;Ib2S?7IV|ݹf4LHG0g7/ƿ--4䦣:/ql9b-fO˜G<-y,u$_ynetgd [ Տρ^LRiDvKYy.Y$ktҚWӺr&q'kc}i/! ba| d 0sYg>LJ3l\s|ҡWCT۠O~~lk|K= &@[``;O O+[]KO^$tVʻFVԶؔ1h®΃X^=QȀqDafKR5\hB:%7&ueU8&H,;r,{v,a簬6Hۦ-FJ!-#^ ] LO 2팪D\T|:[ONQugI8Ķ<2NDw8`fVO$fK}O /nϙJu@BcK⵺ ?F!Eua*hxri{kS}vif9بb(-%AgUІߑp>+g $ qǝOq X851adL-ҕI(ʐ*Vl\OM M^ ƒ|n{f//|r8P])]ЊN2R̳~߬*Dߔvmakh턷Z*bi~Ø #<OP̴ ,q k%d=؉[NWgAt Wm"1NGOc?MDkq]fc+dikuDz{9=5 \a-*,DuO!ڸn;TyU=Do̙ßB(2 $t=%:yrԊcJN]u+0j*f"\ݒ5G³3 9eMzC@+9M5,!b0wcnz$7PP֦7xTҽ}v}Ա1& yd$3dy׽іd]T`Ca|9[6JT0W&j sY°{ S  \TkJ 5lt-USqVdCk1"1eU-(%TMsEQI]5.w6安P.qN\)0y/י%{W8fMFjd=knzeIlZRNqV#hXz}@AעbKѐ]$lFhG"0b| s\%dpk]:s.lԯZGmGڤ-`@zݠ2EB ˧%h'ܡN%`X%A?5l`sKWNkqZ՜v=gcrZ 5Q:R7P*X-|+b1QM~T8rT*/RITH` Lia"C `t9,- dCrAhJ< @tGA_ZpN %e\bmPq|iyD2{iOlu![%Xpָ3o 0eCHlvgŎRYv| c}=< 58 x74g~^j}M㺧)҂!;R\^_ay]QVGv(@'Ʊ;X<o;-Br8n0^96 u9Tg.hղ9Gle/Y8˴cnR8RK#K[EF(gKX8lNK1i^,9nR7|ՏGi'('i6v7M~BVl!qj2u& BW~ "6̲[V-jUɜ>?: IQ,ũ>1ׄv]3 D*>Zcvԡʊ)&t, Y5@ϩ1'PmrE`2NfpUР lTIU TAf89KZ>P(EtIrٝ~QIQ2rs՞qQ/42u>&kQLM fIl~&צ R*\1LL b6;1).7&2l١,'t-Nt; 6å{mc@ϏvngkdV֡@P u F@؟_ D`K=y7 _ɐl/fNۗc~>m.B#UsS:@e$~b8x~!۰0~˅WdiwpۘYi[:m}cѼS@o0:y^X+K @f8< |XMfMNJt}Kbi֜YNǹD-g>.CQ3r?1:ID__k1^}UxGeLPLs6fղS_ 7J ;C5iߙҟDOW  L[CxS0hE>lcڂ¸b_|"+m=s^_"0f)#:CP$&@X%2ېW//Gt!hKAݜIIA}BFNAt #WzWQ?nzYb K':LErPy2R' +gJDm棰QҨҍ&HSmV8LB)!gQm;1͚%EEOZ⣠{=-'Ӎ"yze~ҟdzZH$O/X>)_9=vJ-ֻ« e)"#<9[} H)Oָ*TK7MBeR Q *}/{qЮn3@)0|f 5 5ƩaxqMoʺp g6ɦynF/]GRNk箜.h5GjFD=D_yj+Y*r(\vfW'[0RgzT ZK_s4<# \p GEBwBIʮr$&+@*-3Ku_3  bnaQ*84̷P@ǝ4:B+/[АW酝[ճ^ogC'WKt65Ј d?ir~<{z`ZC3a&9EEˬ/K [}eUf`J-vQg=@PF0_I=l:> lRʯ;勷 F^:3AMNTߊ\5ac1{;ϊ+BZ4WPTbiywiWI7,YEQq@E#ۗn,9WRGe>z_FtNǛ|h+zQٮsa]R{q2_M[LP?͟K7*-Ӓfo۟o͏SAZ-oFS Df gk)i AB*SY]ٹz̮-ڠ.U:_ܚih~2Eoq{yD="' ).ۚƥy-%ҙx|}sGY͕0|_X^VE*wnI-M\%8z N_ysxыUO܀ UsqHgİbZ]Ģ- *>چ2?l޸fVP. R9 o hliei`@цK鮻$ 3C-'-" Y퓽'W>S[H߾}P;ϰC#:]I`,1%\3p.*+\)׸.ZSL>)|/Q?Vc+~]PqSgsOoej~;{^/=^ RUocz$Pzdwp"^ūG-zߐ_IC> dhhϜ,(2g;aReL"IEaM>OY<ߤU1iְJNY[}4e*KܹUfsb=~pԂa3bj&(b\zih; _s\FuȉQJ 7:e ͛."O#HtXYO|GP APCC} @q(\ J@kJވҾ M% DP B։/B)ꟇǴ1T?TJ|bS4HUN;Q9@$'hJ<ѶAda;P(3h(OeQ|JjFHUj5J?.~ꪹPm1.u_Q:[civf@ݣԺuT4۔: h  T?i,7|f@<}S]'~lC࿔WK9)ʐyz׽~⣬JӀTeJ ϧ"dK8-WE&)z) lLW8B^Kjߏ:\GҮzdhg + 6?#-x47>kEvo ט}+B-cQOQi7m{}zWk e SIM` N0';N G*0+TUotiVo+kNq@8KP#`O~p7pTJȸ,= &ZYe|WYMc~`1 {P]O heWM(uƾ[A4a$JQ.[ x",w V 3e$J+I0ɐX(fx mR0\Bk0_?5؅,>!LVO~Lbq_K7(zXܰ A*/On浤?{AǼ~~#3K1i>e5UMmu_x bCՊ)Zݽn)nnBFO];uĨS)a7U; oH%kJɕũ;jQ1rpwcAj70ƭ+[Tv1!rB$y )zf6}#Ke}]8~:Uo\$aES/O=aA`\/^_z8}I| -7$-5YVhlU0+z= u{Bַ`g ;>b8OALʪ7P_ =XE J~>Ah5GQ_ʁY!-/΢gc ~YM д@OujH )5б|W|\&(7(r»|d4p4}CJ"K ~YB;:˖ʹN  gbgj \ᡖwnGжu-cxJ@EU3NjQPQ=;K~y:)ϡ:ƒTOz1u.,s Ai[cUM8Ӻt,YhZ養F =5ɍ>ut@^c9*DN"<$':ǁ6#cRF*0N<#2q40aiyK?Dl~ԳL+ jKhKԇ&VL[@< kHH/(:[М8#suQ3b3\Vs P(Yp}9aEߛh+W3]a4fwV 3gH8JFz gמ\|K#*YvE5ڃnX%U#HrqfӇ&>]Kή, iu]-et)meMπ]JӳK@Sg QY@1̶t1_SS >)@73wʨRګYO)%T&&J ʎ|ڱ'˧8B74omr]FV>tc`*\ȝBL:y(}}X/a x%07>HZnb6TPYf9/bm& r>5fSa:0$ԼY}IYLMmZb^l5]DYV,y>$ř Γ(n/2-Vap!~iU^E?<p+0z'+j /k;ǵ3,g r5p}7̧*"m<ޖхK,]$3SmՂ }I=ujIaW tӛYL?bʙoSeNK`Ȯk'#fe`^K"ߞ?J>5* j$N QS64 # FD#'_ .Kǯ)0Z~%'cK}Heu"g zK<=@80;E I Ŗ9yLhZvpL2Y-/Ydm^Qu7QgquųX rXZ[7*c G;!fbG,_kkm-jDie} Jں2_KYo|yʐW)7.yu[uOls9Jk1n'°EFöZcD-uU J(//7ʕj؋ǥԢi^9Dn/9:^Ȯ , zu<(L(ǯ"{h64fج^JyFTQӡiN_F ?;}Ϊ!LRQ๦w^S܋_t?L~jwX/"?k,[.WNRdjQoȒj#yY푋_N;p͈3c hJU#~dN!~fUYfL*7QW4q#A[cd`d|˶op %RQ4xhfcB3WQLBg2#z,W[jP2t۾Aa or8A*`5 1GOrD>,qtѻ|:.Xՠ.hQBA@tɟhfug^bTXyK}kJ>cUVj@t ` 2Lqhy3˘>7A1V$O߫)9RUwGlW&o5[PD}|lvz|#ъ(bL4 fUԤ܉  SQ1]r\Ãuŗ08V TU fuk:4w*\:k!4{6s$-_[Y070]c**PmdPhQk^_Rص&FNG]:vU xvXJQ([Q ZW];4*߭Kvh|<,AN8gl"I,Z.fۺ ]UCQF_)d4x6;sOv.C?͛:=%Ɩc#؛6e<{_<PGfJM^ !W1 5e?a5MR*- Dͦ )۞A.OzC|CPh4ojl|DͲGtnj_vT"TTiKb:7r9h t*st_EX 9ܘ>֮}@Nጙ99Qr$ 9N&t3txN qGN 9w;x]َzO̷zێzίo'Hxĉ{睉Xf͜c~tٻ ᛉÇ[n09 Zn hnu/ieI{[rZn_wnAF%]Iބgkp-cr,np-=;v5;rUͩɕ$N~(atbq=wPmk2^ۦ,W|S58nyŁ1C{3zff,7.D2NOU+\{ {kT*'*g&}Z77' e*װ@DK,rڮ{}Ipއ:A&!պel;:9*Ic\T$[F薆Of^?ʽÜ$^D[zA*ݸB\fa&Ŏu'[r|>ThdkljZA~|13Syw<_%W )jրha ZX"uKFꬪG&E< sY]m]+g-tuP|Z%jTT7fy 43zbxl~(#6VόT˰i-icq,PΕH B+c2&--Ϙb((nB٠qiAm]Ԃ]JMj́vL}AlۨpӎR4_K_%ODk(X1 CVqmq7^B CW{'OO >$ɓY{P:U $񯷏}ѱƇD"g|:שW8Z%sx_>_>~=ED.=dn\SVi&zk c4հ?KמbCU}Ti\ԉ1JsXnIm`VW]e,)q8\gʰ˜ ÖT. 0X(h5ěkZQ8c GEkр(hllhS۪ gN"l<80+ gw~'?7v #%hM:5aQ10A4VsR|@֍*ScLeCUc_kS5t"zsYr:lNx!5mF^z.i*s]1%?c $V٥@nxcbp$)z-4KЙ2[rz8&R9'.y@}Ĺ=⬼7uO`ƛ~7>o}G>Sgu.ԩOQV"ԉFZzN{vs9w2?`#@4AP(/JB!H\$L+ۤoDEGˏ NqNcOȆJBtzE1h3F oT)+C^l}E~ٖγ&tdLe X2kCP㬉8.s)sw7x[lzؗL%2B9ĥBa!AHH7W&vh_\zhif&sdHj{۽~Euvfkҵ$hjÿI)oy*do7Dqc!]H1mt PW9p$'8a]];Y9J?[Y,Di -j/,R )]5ʼn.h>\FeT!%! Cёֶ.oеleJ.PKCT"c#-P2S:ńӺ+6老0$!Y#_W{K5Z:S.|ubeEwL(UX]~#$6bLCo{5 l՚I0Xu(-%MMA2_HXc2% I_If<@!Gv)0 :kHH~W_olp"M?/5 є.36(O_}JQ!@? )xaKӖY@B\TtYįqX9#SKC c]5V%N2jPX8PaMk":K#$LR1Ddu9̅@$ [o+R 8)Y}pշ'-Y:s/,-3\`*ש6j=Ē'kc8V䧈krI[vLLǤR@f.w0Z,oJMl&n5ۼҔώu _{ G(,Pղ83# q# nQYm?C$gN/hOk\8)H,׾[[K4tglA}:.=kMNni>sc_kĖGӳHOxkҲ 8c|w ҈lkBp__mPpݶg4vzv.ćTlC,ٷC(4KgqN4e^{{MV.J, </N?Fj^9}{[:5͕_HOQ~y|2)z]Q1MH$)r,bj`NGHP9"W1+f PByR\(vTAᰵQD(shbn#GI30x?=v]3>Lza\JdNqǸIR:a]$)mZ,3d3+xaK7L_9osCD$YM|C d@pq9`tàMX 7AdH!*K\Ձ[ T=`c]AFm¼K2cE[Q^[.Iaom [\LQaW06THևM .4}-M63cec^^VN}Qg,pB R Zj̀~'M ²WMunNd/ o<[{e"2fEN^{ {u Q_>}6UZ<޽`ʳT:NFE> aY ik9_uSSf2؊%MR J<\>0Մ鐓k0%Wzˈ>  R=#X6O,LD{IZj  ; _l!q< ^+yc jCA@}M(cl쎁پV0*1OiP&.U{գ^xG 0.$BUL*1?NxVlҡ7(1YR*W&aMoHjPw5~M~\ ϣϴk|-nJPhhO- Q2l! 5wd)zvyRpitb͡fM׃,#֡EءKGfedHUҢ t_ZDrTz󯿂VKGW֤#]Tur̉2:^F[vU:oQt1ŞS1z8s̷w(Ǡ(rrATP܈`%ig!CWd>s.څ74`֙vC{:K:>ݯCSy?j1Wjn >o@/+IY緌 FZl)QR$6{8J\eg8~u 9?w=E8\N1q&EMK%aH+% Cg;sal")N؞K͎iz"WR}R$ݠ?j[&dZ\uq jxc+ϣ~eGPL'T -BxtF^m ^{cuqV׬Uh*(l@tO5$+m"y/p 7GRZ8SaXTSזڞ3=j5U$oS_dw(k5L2i[Н_щDwu;;[4-{qR LL.+& uT.nB"fK;XkZ7m҄"FfPρԃ'*Gl#j/PB* Q;#TȒE-5fc9݄>_g]3-h,m6sxܤ:$nOfw̲ 1˥G֞G{S%dzee̲KXst~1mylKk,~k~msnjǎٶʢu\pQqw2qb$OS,^~QG?ש,4te1S6BLoj#}ET[$bˑ7([x,efRU^ZEsyHv r)'C8FAb_9Gx}iΏwq Ty,3E!8Am& |:ooӾʒQ;qhʧͰ!+E% QӤnĝ՘NJAV\#nn֪W|~2xA;yKKGzsբ?s 5k#>Fhy( Xx9F|s\+u`sf3l"Wm`v|h`@a;nWo~o.ϻpU2zlXM3S^@iƿD} ~<1#ѠpOoP,¹k0RMJupSFjú۹IPǁ(SUG_i䝜L y%'GkEtnCp@ЂmWr굤vhN~ ֨4iO ])_I▂5`Y"FN1`h~qmOԟjbG3n7(@.I7$3#3?f&t*=DԌu@CS @XJk6`!y{4ɑ-<@2[hoͨG/LL-}?Aå9#{f7[#efynV)՗Q+`:.`ZQp>FF%2Op'Wn9?Zk*;OL+itZa;pzX2Rx=l2#)ǂ~MmK,36|Vf{g8cRVVOLJQb0"xrĥD9J%u=6#:XX⩝M+a,"ȟs G04[p%,} JORHBf$z2-yi> ¿>XDLJb%=viWޅ\]RHqT ),L< !שT'5Ury=t*QBQ.5H̢9bxX^E%oKYy$aI۪Da%$^ci˳}5; w4Y* K`Oh21Ȱ\tIm ica8| P*vFLy7/9-ua,XYB@PD$#,$Mg{\ݒ?5p>iAXzC|@m8-S.:RGY}Q u;~Z8(TPnTƗ=υX_qGLi{sy oˊܶNObʤq>Zb)y붒TyAۧ}eUvIv05wn^+_m! .27׋ k<;3l~MlE e%OfTEMHB5x[?_ƂfȢ)"yKxYcj :ڷ 8-7px8kLlW0a| ]UO3+} =VmH$)}N է9vv-Ol}֮hKnuJ>ԤS7ṇH^ Uov ~7uyNRߴ\QM`yb}p@{ԢaZɜo*2Ue/fCD A'9{/R̆_ߖ[dgG%&1Cw9bsˁ@{6b#pΈχ &m̔=k6Tҳ~[J,u!uR(JJ:JU $]X{]fPM9?!HmTڄJZ?]]ms["l%:܊AnKW)$3!Yeo k0 W-ӈ}H.|e\`U֙v6>zk6)fg+|k~پzԓd&!b&hbX/_iҲ dǐej1rp˯$\qx?|혷 > _M1Ľ+MQPOyq FK.[ S.Z$dGIӘge֤- W ZO{CNaX {,9'EfJ0hq9d"-% `Ī1 \;i9w?X=$eURԧ#b'ӏɽj'Nj'î 8G6ݱ%Z,f$2p<#$~$ZsF Lu%R"PPPd&P6gT ~tJJzQRk6m=fSG7\O"'7ezD\{(( 7nՓ./s t v C@R>{9[AYǽXu<}N3[ކWEb ZRQ=_,|Ii;/;sIouK enb2vt1λtdIBLrGЭK˩(0Y 򕝹NӚp*}rI'+dEr<ߗ-A' |zP. $8+"NҼ ggo/kmocb}~_趩υ7M۝5n"UV8|b&4mMIZ cOl.}ݮLԇ$嫙+qo6+A,Ң/F6&발wK%q+P5jBO]I&r%Mф{}>-] M:U5(4[5PL~us5gQm-Nq"Rs,ef /ӾK!@/0qfmi\Z4l =G=Dsu'm>\/+OqNEb Z{'H9DjFfuADc꼆 h5K@-Ўf4jBQ#(I1V\$ -ѥ`Gr}Râl\R#[Ue~*p9v4-%i/}.DE9Wb)+OҩV,">FIdʏժkf["Lͼj3XGP]+83>6VH\JxǙ@ȗOH`b|G| Hk0dLR{aE BL"5s@m6Àz? ;Ad/Sݖ{R9B sJͨ| ДNyUZHY<96ˎGXCZy j%5}PSg=;=1MLu#ܰtVWquE0 qyG\^dTlp}( J8Ft{pu%rIe8pe# ;N-2jCj[X0 ,H|; <Z1+xbKjwg]E\VR˺\ue܍Bɲqc.쮣oʧdFK*Zu"$tT[iPioNl͆Zr2::b̆}g}5wb 2mh } d+W ܏sw߼V?Tjl pg^U)kӪ,Qi젫KI-+9rmzSӂ3[huϝ}-0%l.Ofpzi}&}G:T p]FͲmL_'8|·WwW_,Jqf8/2w.cY~D_.b]PώBl0 SP.RUbW"=EcW-vmŚ\ɻܺ]p΂9ԢZ1- ܜv1l<ƽq0^5ь8Z}ړ[gn pEU> ᫿&wڎ-̲Dmo_tI1*҂sT*̚߂ych͸W8.cZdqUU!%ݛ~v~LnL)K$Kbe% ]s:!oء^B`:@Ưcf`k s %sw b?JwUqa)5/|љ# 2M'#n]^1W]Lw|!s4WklȐ&qqCA0xBG3ɰA9^+V ͈[:"՜DVI7L㋌-^OyͧeB𲝟x :΋9ԮspSeOi^PBљ̆<~Le]Yǹ LX+x'5}l.p~~EoWI+OCR?ft&m;hN<3!bpa(V'|`_N гtypkӃ~D~@Pjbyþڏ= ݴz|n q u[2W6z. 8Bi^oܣvF6JeE,U hiZ'tn\I_wUX_}[BCivV5]ihfv{ȄٶVf:ߵ^6=Mc4 1w,>I6" P uu\6IRmբhOX;0PV1acYkT[EtsCe9g?͖}|,xrX3 9ܤ?0FjiǜwYl.FntʿW+߬ [(b"ݴeGz{([e$GعGPFWAëWo/V6 {6)G@K|dwж];qR( ceKBFS@t2ɚb0B)9z(hKR29Uy7|ʲ_X@Y_~Sy0aJCGifLqevA,| nwzu ÍX 52,H%#y2J`'e"^q)WK <2ݚ5PcvTJv$岟~ eDnv*fJ5B)cΫ[SRbR 2A$ x #3#ܺZPAJv9d"c`|n -k cGQq%[SvĆmu O!v6 qq.&ԘxW1!YZ)\/(ϰv4TH<"T+Iک=BEͩ|˘`nOD׍= 0fHX;R^8/9\hGdXM[`^*댩/m16xgEaK7N]`ڣ8payS/t\چSOm~x:cWzVWDJ̈cj%ZL*=֪,X-~7k˷זŵT!Px@q_y%TX%u'ԫrɻ+dM2*BXrD\)YV@"k& yF ,X} NS v""UIN&#KWN& IC I0iN}#YTC- lY,Uypp2f+fzh"<.fD ĚoSuDPibR7֓g_9ZI;Y"m؞t }X9+m e"o.d!urRv7cViLkۼô0Wf844I=p#:#Z-; Tgj4e΋em禯obҕe|G~K) wp|Djsget 8F+in4 8_4+ёVٱ+V-șl. A5*?gOfzf=Md0zBBj鷆؞,f,i 120I!30%o }zLI [=g`O|D|s7!aV[-ה3ͱd)~wid9:l AR[$yH"n} y pC yq%g}}5m9).,[5G+venzخTabB41NT|sEu!W1-3wz9zCNB@W4\Voj+Of.z/ickpllq=jzIrZ12(61^x;NY0sʭd{IaA5Vy|V2 j M,b9آ`"%T,PgO6nbc}9hymb}HCm oZo 5Pw٫hSt.(f xip\$ oL' t$qY|0KEK8y}kqQ/ }!ꫀd/f5uli:) Inxk0!҄q ކ$@ ϶r)bJ:_0'٦Lz&z>@ 7e# C).M"}B$"mR"yH!CR"D i#H'A q'5#TËFmj9A^x%H5/N. Yo~# K#\1%ᘊ1HW~Hv:=X0.`[ox1?QȏќMhzJIу θ0Qxj#5 JYTb NɄQARM'R@UEsZH>r,qmn2қP"`7aawxϣs4er3-VdTL#?GQ#_Uީ{dcRS0,-=AZggAg"Gy6g{{m5B]زA8&A9):~VZvY/B ^&@,t tj#G59VڞV'ً6Tws5[C7LUrvaP3rVΗL*ro_k6knh6zQlμmQbؿe 눐77_J=;m[siߒVQ|jl 6oTU%7<*`3;edϚ@&B` M-,WXGvq^wXI{G\~R0u޴CG[ JHG$M+:6zs?/k8Q4[B«,YB[ӑe0-ĸ,3@@H~:.a̳M|x 7Vf㴏 hx` S=8TӐ%jҪYa@  ѫ JeAAXZ jR( qqaD vk>?/` "kX^K" ~+(iSTJfP´HfIZ04p1re}~_P-dH0{ǯ:[rwS|Qo-ėTiY>; r2-sfiպ˙.gS'}ҽn0^imt/[wyFfuEqMOY[?HHM7yEjЏg nv=id a|r$Qߤɘ#qhv=^:4G-JUm{zHX7껎c.˿a~ZP_\̑d_Jpֶ)ظʝv(+#iVb e\eٍ6"#.;Vik1i m`T-F.f=At\&T-CCh߫.BUڲ~{`x)l(Mn 9R. W9)~*o{\kE7&)F!pvv%jn6!a:/8&|f>̏{eMHC_,K~ 3Z\[Ɍkx3P69=CHtc39T椊/ȹ/37gûw i a z"W |2tqe>CX2gژ]3*$n(:%J8y\!Jnyɍt]e%?cGʾsB/u7f6.K>=5eZbUZVR-MjfHsPaVVE|֊{]>}#>R-:eem/挆yP9_Uuy;2]0'2d' ,?Z<OB| ;#m5 *]D>7[IK!g1v-dйmۂu*)2?|ִB\Tؚgk_ =_l4"Yɸ3dEtgcveKrb2!~"Z]ECOJ_`a6$5ԡ@6t9QuFĽB9Q$EW>/JEȨK9$6sBWȰ'Ěk=m?9%}>1)3>9E9"=oxTML=Ԃ7(k?>B\T\Msk\sc,tԿ? Emc۫?l &2dj0X%_񢾆QX1D~N0t E 6*S-T4p1zS7)i3dD>P{LDC-7ZTՋZ[K/'8ZM@>9Qkx3"3Fe)Lڦy8ḅNS? Rp U UT/yA]odz JhEqk kEa|{Cp %?qt%.P /^ ! ~th`;;f{:+4)=+l||H7)Tb`U Gzmڠ00Zp!v%t[ߪx~>__o5o~N۱!c;GS/+ΖAېΈXUq:ͯ2G} qJAYo(fB,;:yZe*h$Yi>O|SBG&Դ9&`*"ţ{텡]wKohZQr):82:KM`(M#,!H-V]T:ofv_3Ift1Ky.Qܖ˩/n˴ꍷ1#0I\Xᶝ}=_-f\7x_+&:_g}oK[c<]vfU~eehVƭevyL1×YX*),:-כ~ 'Y;L19zA:ݯr|;(s'֜bbl?h?q(ǖ˴3]Ӊ`j-8(%:4vй=ptQ:my'<Ų`HHU(xZg 4-r5LLJYrƬ ]|760&<*F auZTAikMqot9͡c0 ҩ//CNqGϐahYRĻJ@+CugȬtdz0MS A~'}Afo o wg/%70k'z|'hk -lz$@a+挤\d뫟5aU@\4dmVANg/ F5V8ܬ}xS tQt֩Ul/-^vqV%D&cNzafA|j+n) V昍iYm9uFv2}*3QG}듾 }U->op>w^-OF~i׋ߵmxlxA?wr]i7h%<qG[ _>⎏ |{ .MGة`ۣ*^tFr# KhB50J5he*h+1l[JUW|z]mz+uؾ,dJ:C$z(#ik*/u^[!)DXY,385% > RE,M)ADO3H4\6i) ˿o,ZpX'LN^|֬lDb-sY`Ϸ5b3Ѹ"wơYq VƏj7YŽCŲR xJބ$5 <`kNLc9 NZbMƀJa?{ZXxm 6l 1Du'o𖹽i/-A3&PkVbx?)-[k.(-{_T&}}:t³hY5!{%Z\{.?cLJ&n>24Nb&p"= MS% F{@s.RF$1.ex0Ύ84!҅]k/є>v`-J99Yzm_*7 .L>?7rı'&~_S~OTa1~@`dh"A |ү;{C[d1^1AI6gH:ٕ3.TH9 Z:*RYQ tgۥ]ijHa ݅Bg܉v$v!LwI0Udł̌/$tRC6 !: a^\]΄_^<^۳C|! w|5M "1RB>c JFYXvw7¨)@b둨:6BYYJ;[vHyDRސ[.vfrbKSUJL'Xg/wAY1e0ӎ*ّ,Ѿ\ >s sROάFQI=- c 3]Pw6Oq4Zى$]]\.ű3#0XrAu9P]1DWjQD4̄224Ͳjc0kh[D~Cu@TdljFx2cC{wizٷr~ Hkb2e7#a\XW2SI!GpΒ%m8Wz!U(3Spnr l~r87 ̵% L05KCWءŸ3~vn&w><|חC- ȐJ*::2E.R9Ž-ZR;AގpȢYz؁{D岹>=;h{{wy{۫PP?^~ʶeqH!qVT^_^W_^$H#!u*qHXD58OKFMv|؀bDAGSBEUCaih[F ՛%\Vi0QAjZT&3 1KBuDR<ƕ+8=YJׇinLXY ..+Sh:綴:~{ox'3.sNO FrN̞OeӲ䜦ӡܔbLGIAɻ/y?=9н ɧ, ՠH#$jDq)S¦GlZLvQ㱃v^&CI\ioy(5.mS3F.~3so`?%@ė+H闶=y%wJq(i|=JN"" 7:\$WΌ>]⮇"niZU)t2[ 2hU 6^4f|z۠Rm×hBBo7Q4u/뚰!B29_4ςn^QdX⩰sr!p}9}#E}evv;V|ެI!vL&d#Y4&SA#.Fւg~\ J[L|N9Y㵰~a!RO!zET%6$.mywYi l5E22>H&}jf65[ʲE/9/ڳ2]#{:0[L,oDZL2I~2 ]hC&pȉz 2FqT,ְkT>u.{ veVF|*M<1)x6K|4 QQd&0ٝ1AO3%hFC^ QJlblzC5!dQ݇}Կ3QCTWXKg fs1gԬѣ#Y8VL6 Pb *iZz!K[^͜hK};9\TP-Q*3* :9{4cmKynq|F}D7kCl0 7lD5ϽK)-˿ͤ!?*W#'9=# T? ɚqVXL[!SN2l(|dE ,uuo,MEF,+rG,m 8MʙL-S)4^m )ĭO4ɒn%Hsۋ]ǾiQAwn>ao{WH g:_Ng>J5~+Eg5.jUȾeWUiv0nw? M PK1WG{ !M!KsC llKTb%2Bv"cgxߌ%5= dHKn2= ~ sUߎ¬*Խ0ˈʼ)Vi#Wa^K-/ 1W0E0{F¼\7; A){BaF!rQ;H~ڜ$_56RY"(_ %v9J2WNjKW^W2$׾u(c1S7ݩL+Ūc#3{[l&hm@fL_2 tK~S]I=ksk;ɍgI `B(SG.J[K|˓ LHh=SuPdv.mj#]|(;ouWjSSqSS*VZKq OojjdT(|pLc1yX=!7țꑜN37Un;Ն>Gm#w#%Pqϐ!>Řrۚξsx:Gm#M'nk_CxWJrP"r< ,4׃DT vNK$#st(BJ\$F\6WIb#]n M)ErNUQh}aP,- ^jH HSuսSCvIVAjɑ,9E]yj37 &#(=);*6NJEQT}?e/ TD.8 >tn}6(P2S֎[ZS j9+&7̲&Vٮ-xfdMGUć#ÿF\8&޼oto=y?r/zc'}̫b_$$qZ`V@:N*ڬPX޶~cC;`?͋8wHcZO+T/M6 Jk f3x@{so3#=)mQ_ ¹W"; Uw y I]z}[iOGMCu._kneeAJр7q@i[c˲k~-h xtDX Œ',DQꌰH'Uf.Io{zʝ% db*ʶ[+*WߧfgXc[I`cB j@eϲ X..1bgG,Ԅ *c`;x+ ʇ䘆4pU( , 7’z;缨ay@Q,s%Rb"=:Mѯ#u ,/eJ%\Akɯ4>۬ 8އ+Ӥ8Ac(\x/_^K*H(4'>XyJF׻%Oy M丛^u|3לʠL&h9~ u~8bbNF}C|n7yZ6@/H4d>Bl.ʳ`RnQ+GA`B/y\ py|HCa榖rG{PjUBmWp͘[(!׫E; f{Q[ىW>M7Md1PPqYmcɲv^wٓ_}!|yBKsF s@odxG;9WN(N$%m"f=2i`q0B5&fY3},-+T29is}{5-o7G{H'Umt^cdHEjׯ2Z|1D%r?j.mUO4ZdG%Lv2%&rMl5\F  7AH Ovi.L|;t:>b]Z9ZV "oOӹHd1|.w9%唩EJU$;(Hk;n .ބ+lWYX= R$섯,t.Y҈|b_9*8u: F;7lVs-FꯒvʕOE!yD|˸kjdc^7y=e@sCXl8z~F4=!^?S\+Al@`j)@ GB˞'Ɓm 8-?H& rٍ#ɡ^_? ;ޏmY7hF{a/%"*IY30`3`ODRBr"T]~^30XdQȗ`4Rփ}:iDT'$X%eh'7Ьv4J"$⋉ htMM !ȖIǦcg0D8:{L+NO> ;HcZX3(Y` C4x B:vY/rSffUlat6t, c2XҸךTy߆ȓitڲa'S(zhQvӤ||xV)^YI.iİ*b7Ad"ÇlvT%EǮqSJETpRļ)b{S3#\ "{S lмv,l NYP̩uHdE."W,FM"7Mt}D"1CWe &B& ÌQHWncxH( @L4M N].cZI$MFƨv;η/\&R34̼x&;ZP͌!O?ଫsC 78#='T 2QDBs ko}5]]?~̑6~YWi{#΀'/`vthg\Җ{[`A0|j]&[Zp D4B#Iu3"B~̓/L$Fލ4E8h] 2BT%}V>}KG,'8D3!`q EPήb5Ol jםH 7*c{őJ޾|I %D[)ly1+7׈'4p.ƃILy~I(bPJ* ?_S eӻXzwFLU2:P#K8~pZ  vX3]5V2*?z/|oj\*'nb18k4j,9qj/\ q!(˝fybn5;\ggom"u+@y59OݔyՓK4AeOH-xgY v(*-mqaģ>|۪r74jyi3ଫ7(nG#9[T#LfEA) (_vHZ+z t\i`[8ؕ2;'@~EG-){iv Qk)]trmk 0 ٷ#[h0U" ۦm䚲ȔBG2JecXfƲRC5e3Y04cY1䚡,M475p٭(rG| g+Kίì3Be݊}= Ő^Y6̦ f5խcd[Ac7u$΢[Oos =HRC΍ K׹1R2(QSڡ3iKEGy3?4"u-mO>RB\0*8k8K7Td?ED4P>k-[&.Dr_C ix0&FBbױ ߽ olQJdQ[uNUJkZ:;YdPq~B`S>M7Ehϕbo;L!xhD}c6RPBX=جU>2cLp)N6ߎ߿ U #+1Ju`6p4{{ӫn p_2EH+EW|U-{TE YlYV#ibYD">NVH=ٮ{D]I&g5}i9I'q6G&Khu, n3iQgW:'gn(r 1sC-.:;}D|_ҌW7$`}~-⊯imF̑G )p徜/T_HQhDs"a\@s__/R(ZCwIzenĠ+Iv+2D5+Jf*z4VªVsX2Y6#b^')jb>TMia詉S?s&|A ˮ~ 7F8 [`p`Iv2P+IfN4,_'nrl vQMY/x7OtJ953j goԗw}NBqm@x5&nۡ%,5 }ay1 MQC\e=K -pIt00Ԕd-ޓ2* Af}SDmU M* bŷTX) RXJ :1Nҟ'&ð1_E;⫦~}Ks"(/"qܻ+^rfXLXcWHbutװG ^/8;XզcuWW.أ(}q?B]IȲksB޽˗_WKǒ]P~r\k[/r!%ާ舻OI:Mvm<׏3`搓TBU P UAV|-6񃮸(PK@q|Ӳ=_Y# MlQ 1%Pf\' $j ?@ A?[LE""ȣ$=[ES {o7̈"/?Rx:&tDMMhʞiYɈɫi:XW MqfgZ "WnT/vZC˱ Y|"Hug5+wlbq0;\ 86qF&@gQ+e7Gϣ<K,Fm:ᨭ(GP)jhn iX[1fssB-(* ?8>{pIrqMAwdkKZR7*.ֹ6BlbPmd(*tMau|KNImؘ=b$B*v}ڳ9Lؚ:Mmsʅ3͡-6ˮ(6jzu,|iAm SIࢎE]dg?& ?UPr:Z\F 9@;VhP i oЈq09fp{y|oΌ 3:^D\cb"Q1 :0D0'B,({eD iOdJ>#?:9^Nމ1=LQCy?'t_uozc#>2u_GL(8j.wY %sv>Wehy{BʢC-.N,=*y]ݛTF{Id/}H[wy)̇BDf(ۣLd*.:]HFi}V3L ^m5{IO/'37×0l4x\3dz*p>Nayx5&1hW&H'!& @=%8.T/g($ޝO_>JtM?ꅤbNKFnqzrUIq P~y5#Wi"1r*AMb_>(ypb{trEr#7_ &; d1w7@W\u3RMv7؞MLu uϡvP~5`D/uw*wJyL0 }גe4(\"u_rb{>}컪 \<^hFadO "hM@L€۸hmj6gX}LSx%1Zs%"Ǻ\w4ߕJ\?Qn⭜d!5 (I9Usx}eJ~M@BhFFɡ$(ls9kS3)*P^gIR9ǿB.?J,BND2d"3B"'BB GWDE!rHRd"_qG.q+Dv6!x쪔~$ʾc%JХ%Ri D9)ncͲ me:K@D*^ /.ӤYY|Jq펎 {|ѧ| 40[4 OɲyM Idž]עc|JnYmę 1v 4Ѹfw Zn8#'"!HBOj(coؙ$J ahU0?3KID= .{K Ats?#縏I2gx՛*-)47p-jCAn#Zȫ FAEpa":o#;`TV2]1ꨗ'DU߯}CBoJxIv<>5ecC ? $m-Ը7^rQ1QmUlzݤY^{OÉb_'vS3+0f3!t3糼Z(qԑQĹW\B)mD;N[~b63%=d)'˹L__O0-mw J-lQRƏh5KYqm'!a&x)y!VAUխ%1,rzxdr2ӲzVi/tUϳl '|%؀iwm~WI*5E۫qcѸFv4-0/$*KsZYu\h\Pd.:#[6ퟲxh0n-oʶ2J&VbG߱dZt  1q5]땓yۺJ4=?FScgN6S*M|>;u:˝(6Up&huzNcَl|zҧmݬ\Z!5Kg{/:-k\0G~'`ϐ˿. Xq: n~u~ޡ_q+l^NbR252 OlaF2*𷹍(34B.Ŋà}~%_{{mɴ?T7q _W):)'о]{&FMX'WZzy)׺9#.<(ʚFM}f|\iK}a~y2bB|8r"c!wܒdziMM㦛L#7dC7[Lzvw$c ]%=q08B%[T~Xa}oYVo)6>,ɝB^>J`dV8*G r[f~)թ15J\)XSb|thmf=S*ڔt\O)>_ۗ9n )soC lHmS@ǕzSuɂA.Gi.,V^ j%3G\(ɱnWI6J;7Δc;Z&Sl}`~ה'اT䀊%x i 0Y萊^J 0B ]4_-}CcfE;M# 0vER hAg+QUhPُ:jaL^hdrơvĎf4k8kƚgFYK]xVlΌb#7Ɓ)4M"N͙# J|(gѦ$@>+ ޹A2 bXA%^kL1>tWn}%\(tkBިVC솑z1tu8ԬG!A3'@2kkB0(KžĆ 3Ќ\3 u=2wN8 m1LP``\K% sW)? d EpEy9vVEE=*_S%X+cy0XSy{$n7)ʆ`&$:rVg۶-TqAm`+C?/ko`Rd5WqqX*5i.r’K [` \fiXKĵn>ThT h3~&7Yb> fD`0lZ(u"q24)["VKgmU[ FTl_0WfwNTi:~1پڻK½8sTO҆1U^GHZ (Lծ8nPS3m2O䍉GML8PJl=Q7!V|#*r,V`=dA@#r_AlRvPd}Z6 EM vq"\ԡꐵD ?+X߈ƈRX:X>ܻ{:``T 'v2b:1z>NC>{WXV T*AZjѪAHQE`vu8z>Lr`VP!k!N1CrtY>(^:p&`YʟU+B)`-\R7U`Tk&Ʀٰ+.[IRFoAv˕4J^yd),8l~o=,\PX`xr"`~mܰ!ߐŀ:ݒ(ԗ}ߏ0[z6.F6wxSF\s&+ K.C[K^ U`9 zLf004W.׋dԎJ HX W1BH%W(ڍX%FrvcF 4Z34G2qՈF ݉fLSX7OAOKXchT6ZAWԫAQ$Wba2cYe}++AxRR~VvlbdXr˽J&cZZdW'Sw*'CO⇔[;,r! P@r|cZ*,1^}7.u֚f%Y76ib%Z5R*d2_BU BS2YƊmw Q_@2bjaw uIL1Wwc]N nTXY`i4b M rj\:za[ ꑥ{Ѵ@}7,LѳbZBhOE61%ڌw!42IW$de$1qAF2#ϵш(63KJd]2z%sccB kJ?/d-/${DKAӬ<2eEL,w+k>/RXbTĎta[& n^8<1*n{\~khU*Kק}2NY$1/9@Kϗ6񧒍 |; gě|`JW(bѮlN򁺦+bj(N63:z L6||Z_-^Ԫ4`9E^%#YY2+- VKd V-ʲo?>}YբpgC(t'CnH! o q_5[$˜!صVpiSK>VYR{.4IAo31C N8}UFXڦ".RV(um5r\8!|eSc߯,^d="K.vϛ(w4{γX l~BTRE>eRƻbٴAR*B"v׍  .|'nCM])^vniM!e:4PR J`J'PbyI(.1O#H.a|}ByFWas!F︀׷x ~u!x ?>?cvEУf<]XNa_*|u=zA*VXxyPF4{q9[lwLE#|}BD߳sj%$8[{6AbdcT49 3Ȭ;U /oUvqT 問0oB4-Ը2eQG`@0 u,f5d14vq%ㅰ'CFbN煙lGduWvi㨉5мP4)%Y8b1W3to)&eD+1Oi"OpE`L&L|)q@6Dr [$,CLYQ[!ƖWGsB";4m>pח`Ofc"sQ] WgemcMZDs<:3 -1C†ȩ[r6?N`{$Y/F(F4 +qDIv=5RɓJ9 BvOJ-zhci&{blO^w$WMOR9fsX2l\a >M"7u"&6Y)TTŗHTg#6F<rYL8\mEɠSH ~|v?.Z'V"U1YW+m ^!ҖƥlWzBsm /v3wd0 j2u7GM$E NQgI 6Rvo)$Ì>ipw,i)CY'aIhzR a:!Ҍp|v91EB̳S%?Z׀RِP0AvgEkG}tI'1v, ^r#R8WPE Xo#[-\TOGEbLw$wFXBecS6&ɕHӱ= wxj`a*;}p|UL"eБ+jUi;f:@3ܧNxĜ%iqVRJ( ,m5" Ê@%>,K-@Tq\1ZLU0~sq^y 9xP"TQ,.8ZMi3lO)8kϕ֛D4O.㊫Kd)j([=A\zqe9iˌeO,كr\p|6P86ú/B1XrwyOYfBTc@WF!9S0@; f,m1p>̿0jI07:(ðjT V0F&ev׀;N=a^Qz'I4L%I< %e25N՘}Ep|"I#(*ŽC<~/{ Be0|m`CY&eA42 VuU/r#'㑆^h&UϿdrGSGDyoaWMjܺ6fTu{Y 3Q%)YR~9TzDh 3Ve&?T-tΒC)@"X^,pHkX*+UP[XT1(Pޛ._U|g>')i+ބյMh;faZ4LZ-SZʂ[3ޑI[(e_Qfc7_"KS`$'\|¬Y i,*DQJ&&P-k5>غ0+P!11R?ewH|ҴpUNiz޿%_·?e DL!y+h>R(u0#ͳ8A8RIR(]S?Š XޥyvIt.+SeLob|F:w_)bR 蓬K{+j-AjҢEy2aM8Sx ^WDR)%U3)qR{83Ln/S)0}iK9Wy>gs*8dA<{΋"o?WR~ceDx)Z5 /NWAIԂۚx)>q(t*.o»U5| f/n(JsQ⚓fz_ }l'NÜ8k㫟 㺋U/t^hsbfCib=B3%·,Ӧ*gfj_dz],V'M)d1lKKgkg{$SW0]vo?q:&=C]ӛ8}fi<}?K/fM"f²kz)g:!d\N.ʊP~2,ap`pu#'dyn'zN|ޠoV] +ܦTV8BբU\ВإWo/qkӝnVuy>GP|jGҚ?|IS݋Y_w'9i@ `II`AJ*goQLmh6U#Jʺ\[ YSOO_z |KNZd2!5|h0T8,]Emli\e헇0*gYCl[8_g tr;XG31di]3P#Z v9.mxﱆP{jɭ>E.@_J<{ܳV HLkPa],Q/Y Ɩ0'z-lՀ|d-QyF9Hu QVa|Rgη`b tcbOYh8mCɪ݁.n=OB[K ,҇%=>+W6Q,o.L\97rThAX"NQ̱-uMf Pٌ(06 y`*Ѩ\=}$Ϻ<'93l Ũ>SMd⨜qL7u~̚SEǂRyFHKF"24[7놇E 'SL--; lht_&#j(u]VǠ^…Rdm 걤(fFtIʁtJMPLHRcdGx]ݖELqa^AhҘt-FC 駝(ՔnrQ@6_/`ԗ;Hޟ|`hx؊lKeq6-F U#启#y?NIU ׋$+O> *`DwgH5ܭTh$s9Bj'4 _[s~BoU`a:'O/s4( 'T<UnE_"7~̦n5 Nz+c5:.`Ck. X q aq$'sp)|[K: 0[UD 'upqפ5 //$1AsЮH7tiO9Ƭ~]>1Czu.=6>(DKGM;h0-Q5abqv\d5'!l C (N-Mݎ0U(CI0$hmL֦6;Vx` M[y.PGPha|0m0P˃a`2fBI异ZyT1 et `f5nuݮSP`FE5"T4fId.[,!E[ahVk$sU͢dK*\[NH|iC!ēi> YEJ*GgN؂轷L,KY~BZ~ 2'@sB[ƗQJMuE;;O _ L<ãM`Y:>~Yۘ"\ tŔhߞ_~l!Z3Jz(\$ ă84f b#X0bx/ H6/'DD>4%K~I;݊ k܅]SjpQAQOk/W-@l񺇊+J,]S%h,Mر=4Ik΢ž!N- B+~ jUCj,C֜f,(~v^{/G;S 2bg5nhb$ս Dv:W[ZCMCGa^uzB?WZ6:&-5ly *(84"uiRԓl;*/.*vrr%G#FU?mHR 鹦chI|{Ӯַ|R}Ki7Z|";i&UM[lj u*[?zj a=۲6=6g8S /lxzxI)<F%5)r@ >-2\Kwda<uHC"ik\V9qI p̢ITRAShjN4|R jR+=܉xn-WYh°81Eu"0/iF=b-(ыBi+B 0xZAk'w8F@q`A%#XLG$iɝ7E|x < hUq=FwҮU_\8zfc/ם|d٠4OYĝwZ3nlsV+l,bF:sr=*QuG2Q5(^*;wc,6:X)-0U r@#Zyng3rpԦWk9^9o7ߤAdCkه:V'sg4.U \K'^Imrs7mGߊx\˯YLP;ԦIGΆ%Љ(Z&іO#ۆjKx~ue6X 883@5)W*d7+3VSfL"F\1/bbu3*9}U,z=SmqS„"~ݞtwy@1^rN'(4+u:%y fYV%i@@E}B:=YJU8K%'(i 8Qzg+?lCN~ r8v;~xC~T˟|yU`v{:Րb/.m |a0u_Jsl@4NMJ9nf2!:TD}=JQZp__*ݷ#XirRw5nAG uMFSu n`IEm/P=J98I)( 8jR&`#a ! ?(1/;>.jY7Vhk<,Y4sayi-xQϫ0ܯ`]71H+:H A:ӎrja>UN\Skފj#4ω6Sqo&n}t73'A^_&{$ED Y-SKoq%KfQkߛn6/gzXֵu=87PZμg!N`l3`+B2P"7 yCA/O^yVJ_[i  z:7P=ndrs<sU3Wˤwwz}}`,Y9 \t|U'Y)SO}tO!/;MvMx&4d'B^+݋}_ LT߫w#پ!h 4MNOOŧ^k36Ms:,V˩Fδ1m 5[Će:%j ­|X=} 2EMژkJ#h52#d:ЃG;] 쯁2<濘8g?wu"p͜Š*qԶtL0VcZ<8pbE] cE7 2˜|d2Hlumx5BAf3BYge:;͌&:#Q6W q"^Qr<~),2jŊ AEp[9Vk0. W*jMԑ oeO0PȌYؽү}hE<#U7I9eص>[JG#5 HnQOkɯlST)hUg;Jz$RNFR=O^pZ҉i;I(i( c<age_;Ҽt 9җ%t9T%* OhPBws zH</gՀ hqC8h ʯ,:#HHkJcT G[GܴXXrf0Ayj\F9fk@e @Zc[3 %DŽ¨%ѭ5ָr:])H!Нiုfzhj3$MP9.41 9_6X*1Dh2mb՟O)!4V J|# 97钵+#`qPMr3 >/E6MR>nPGdc4$ fղ8>UFK;d٤*5umcưb) 80<>dBFMejT<_Simޢש>gKzx(jZ2DO=$S9*!N0 *JFYʛT!ȋaQ((::ֽ9l&jƾn4Z GGd'ky7cT2; nT9jD[UU `:KWGT rE?}2PY]N"RQuJdq Ek7M=y*"-Bw33sBUs?b;`ĸNfOf8RxA0f⬋;Ip[Ҫ}Ri{:F{x!+'`)RaM2$n"M <}!4 c(,"[jL=Rį/);5Xmk9A9ڧD7\Ik^UnJ1UU#{dX;T#dz;nU&@D͆{6 HawY2Dvt(#~ G"VJa{n6HPVrH|ʣuu0C6DQ#QU``pC%Zh=:Г;Gﱍ]nLk 0=؏xê%)*rGXz-) ɽat̳&,ܘV/Vlˑ5v&ڞuSG7H6 ⍲W`? |2&H;#N\\Z;qm nQp pA /,3 Lz\h-nlYhkgmô? 1P+(۾gzy F  $v:;hzlH,+8΍6ײ |Za>umg&2K6OMllh{3mbh{%ڶ6ZKb[x=nRyV.~'Ň%v}>`îCmdЭu[tgBnvq*fLcDx?qM~8m8-oݦ¼%߆_ͷ<2^⦫S ꜡5{PBlWo-%BYz{sߜy_Je[>ͷ}o7gO\Qo\ ߮-ȷ|nķwҧ~ޘ'jJۉovnmn*%n' 3v)ՠUSx^Kͺk nC.ݲ/A4RN m#6ang.ԈtCݵrk yŜlAe mrH3G~7.N98XR݄=o6| gkeIl­QK=w]-=L^zvWJyE6d'=nm-[y.╝.V/ɖmT aۥpL-"$e6ݨl'ݖ6u\=ſI&maSX8=7]6d<6}5LqWS:޲9vKgqRȮf4mݓOQY ˭'m'͖C<\Ovl!1W;H`aɍ )kE(g 9:Ko,9䮬j6PUBU m(ٴӉk GzڬجAVl͓bz'7*u{q,unobܝj&Lݎ mϫĴ݌ڞDŽLsO\(U9rBZZɵkm&³Lki :;}@zyO4.cFS{ՎKl!m mJprLqIm"l+=̓w` f`{F'Ͷ]?ѡ̍f3:CŶllnEgu^={b)6WmaNnttnO_b(W\k\nÌvqVloݪ^h IEBk8-dFy[%Fт5Y%,ܗzoxOVNh Q;+OmnVf̶8mK%~ދPR:OFP9/^N?Q<^t`Mf3jlfvf@;21$mfW~&w݉fם`۝hX!hK_qY"͊ l G{ɋ.he[h3$:mEM\VͦKV4\XYf;9Q=g>JzhY}clCۗXmEaRE^4lj$'-}=w'wx!^B-2N5X{(餒Byx=iyRQg8RBע' P{lUUb:ӓ=JxVLvU* J)m2& qrAԈ e}-ÁŅ$PN[K *?)iC%ԋKʆiͲBf<ꙌdS6 rl(J@;+苒*0A*TCWnH٭VPE.9P˹1P9#fqܬJ lH)Y ME-sao;-o>(Z[Uxn[z+RLj"fң8{бd!fjD[MExQQ1MUA%D賷i-^NGWV#lg\5vSeyX r = `)Qv*m.ebrBoC_ vdzv!M"QCUۚZ=Jڣw#"7jOWu њAx5<`e)튕\f)˰!ǮnKYTQ H]T1J) MHU ENL-rx(Ia$ISzG\ڊEc?Gegﶠr">[j뼼|\yXPSOq?ʫi{v":S&{%8z%zs&)ltHa :ld? 4MKJCl4+(ƤwxJl*  jɓ: .R` sM' yHa+dk3RfԲteȒe[MfBJ*Ut7\#8OQKᙃX" G-O& jTQSl0m0|e3B(;y-@ysG"BEc>ʛ8FQF9EoN )z2<)Nٚځ 7gziO|)/e nMx!~*FB6){A%RG`:lV¼$飲JHqH)F8+f!讪#9`Mnp mC}E"SWY)r5 ehΒs $q lKBA0?~ ᇢ&0Ô}Ozq R>X盷O> U6hJ+r34g*Ԃ d%2CѝѕQ }GmYMG{LFCW Y5gx]xdɀ1|DqXP^Fܘ7c<* ó! ;,Nܮөav͓eq|Kо),#*#pWm;ize_ۺzѺm'F862T_\< \MjcYڃM&p(+>6$B(LrMRLtQ:xmx5l_Û-eڠ]63(}QIwahtH2ȕd. l4n6FָB&M.bwAǪgU+4t#e@ ̲^%'7W%T]Hm҆~(UVw{+|B?Ak\QOkn @{Y!F:uvʜ|mskSIlA'N#q~\N4gz :;9O6o Ed~!]רF{23D<U+E!,D B'x^PCS*߱h50'٠O(b b7P]EIMГoLޝewܹGWh ?o#oHfC ]Gch6C%N}깤q~0ԢtGl$C,lS"o@ٗoMs{ )I5=%K)Y9bh}Q^XE` GP%cf%s0!BHeKȭ~1G塷vK`/ZM%fQ!b]3.CQNInM+'Յ2--$_/Ā?(szº`LP5In5)*9ھd"sU)z?AW)* 9TKW~נ'GAoZ=:E3:c?EO}KO~"T4Ռؘgqx Gu]梍%>ҎCk}GGeOX*1GI݋7,4?x/Z nvGuE&A״lQfL*EhpYos3tLb\u$$+O*z-NyH!:hS[C1ơZE uJt,%.Us.iQv%U*<~'uJ5:aGW.b'J*nڝ̤X-x{k<_fnt#v.,xZ*n Y>U&UCP^Ə[ڹ%vK|e 4/h[}w D *VbLm\I{,t^;xEbySGyINuʖrU,_<*j7g[EgU"<\sy pM|yzylCn1ָ>4F"QdƳ+q൮GCLZr愓g{-s\]8O7ІXd 2/}\ϴ<`7@ ( , іs+)gOn6({;6?[e9mV`ΫeG#+F$y5`t :`% 3f++`jkp51I_{vl[6UΠY@DF=͞[vm& zzoMxQոX}lAmVoV3j1 'WtM<9m-,g0Wy᷷P5m4Z98س^y$zp ! DL쎐ߩb'tЮ݂~-f &JUGe^mN|0r`'sn3G`c_9/j-*?ǾP3+IV9-$IWJiN'icu?؎pGoE^vb^͆;NÈUƷ:0(`#]yl.Qw$cZ3nHb8.chkun }#!#53B*Yh -38k(Js 5`7Ӆ֘x}a>|e b{)L>Q~Pzנ/")]HQl1b,Jߝe\ TDOVpz)?9OV=t{9H:p~SܛgsYN%oa6e.7li0Vd-PЉ5M5phi L"L 5fV<{=Asjt2 <'ues  ³1H$ht,?׺ݾԭ{@;M(Et1 WH28"3xnh1MIkNYc*yk~UODK5ߐM%HlӐ_l,$=9.[7#u'(,xNUP14qRyUMoӌDf )R5 {cLz uG+.dY1==gU`ulĢɊ@fin|>6Lv)/}g #zf}/{D$J>'+W7NQL8Rrt@Aڧڍ}Wk[ZqZk>w7Z*#4z1<]2B#lG>N> 7. lwi}&A0>Bqr@jٸKD)up!Bxd䈎22&UZJI]7(F-첞J'5Z7Ď =Fgl$~߼ j , +YZ!\j'S bpUzzA{Щzϻ3V ǍG K 2`| A.=26vM>M 05Lxڭ~*ḷ (+Je(ι Ѡ\3IXÕlcb&CJXAKpJ*pDL64g•,XϘM Y<eL>>-EbKu|e"q>+`F[򽷒q1퀽p\h'TX_b޺py#`1RA$ U P90{i@Ȏ%Wr_ >;KU=Jz8R^ZYF;I4-%?U_gٕzU1jVލz8ʶ%u׸Fc>+--sRVOJ6%]w]v{IS:a~̯#_ ch+e߲G*%ބmyBV]dv#O=vroPq'-vwʉ0=bqX˅]9̯ /s`~(XYFh W}3 r=;3M`X>1o%!_VZ / w,%2 (Cc>XA@g+8x_V7ڭk+T*C=ODU-OAd<t0[-u{ ,*΄̰va zCPiqcΰ]Kh҈ޚ1i-H⬨9s؛JK@꽛  A1;割E0rNydγ8|Ee[H=:7( O ntԪ(ukQsg$2Hzi ?3^PqF.mV;7 _ ØB\ ސ!ɉV`g۝u΄4GÍ24Qk<ԯDJjC~#-KgY: qw x*OK _J"1mA#I(>vLZk,8&E`j"UZΙʤSԊ<%t95sT4͜|-6@O}: 3o[簣qUΑb`)ySkieQeqZ-_ҩK"Зh>-KPHL=EsbQH.}I٤ym戊,-YSY )8*dҟd%vF)ptP ! ŃrU:eբ\y]w =zY(Q"̉f<۠aMeARvo:]S-4&꼲AΡZXiq07C1{8˔TQ E74z{УM c6`,dxOZ:  $J\6ԯEmzB㪩C:f/Tk2:8UV-Ff \CwjHg+^tti}hUpGc?2IVV4!^u:#,m-tl+ ])KUFTx_pqѫ1S"w T: m| H%vҕ fOY[ j]/US*nEcGjJ$L6hƥE:?utY;nf%z+7K~Bn@c=96O8%;h;h)$ޛx^FZI\C>z3e"lCytThh Q =:G6(h)1d-TE[EfKXq[wki֜&=DP/<ދZk Jn)u`XAO}$&DQ$/:>uφ_z6j q?ElzGɚf OU}30 :NK"~ #Bexys?܅6kQRqf 0Ař;Zv$3çYyP7(Ka)&5 "ý' _$ ft;MlZf43lB#pCGh!TGW|Jtk j?۾kىD2S.uEQShXLtsI%9ɵ+ҬLzs6g$QHoy4.V *1GKlIuQ=?[ﴄ ?ȳ$tӄN7f\BBE z~SGƛu% "?m2c {PkҘen, 6Hj-_*b_ n>]W`W wou|gfdZƪ[?2k&ҥěfP%EVL}O(> kfD '_wHG;A~|x+N=ԐQЫ ѸY0˯:Dʉ }?)sjǭV(W]9'bmKBAuIް֪=%~^:^< ?(t#Ku(@XWbVWTljU˱oy։:{Z3*PmE`!vo-P%'ECɾģ,EIж TNH%8DQG#]3M#ꗧFt㧤-lEt1M޿DWU ~SWo ׳~_#t lZm_uP*ܗ2iya牔ge|\O.\=γg.ǿxr9=2ء31)lUc0H(Aijmv_OPHw咶K 8)i X#͈Z0[_uX4SZ*&XY H-]g{])dߺ7ea&~"M~Mĸ.Z`Q$l$&D" .Rl(oz |rLS4_ C/}ˤRiy(y/ Z~0[f|iƩy%#>,^DjY6Tw4M6z6Fk VG|EcX tLFM0NcěeJZ 7"SAW7JY4di-uvK-$طcW0^@7C|2f (Qf4"6E4L۪M$_fV ~fU4$4 [#qQ lKU'O0F SK˅<MN|$A ac#ʢ49h!|^s Jߍ:R/gz^wБ @Q>7\AHFWwdG"H?yz3z,Tt'I)$_z*0'8bVbu4·`;}^P<顗m(?:*W$?p pA]V3Y|ɅN5:(h}u)]vO~ZgFLSFGq4cpa: "븚uCp7 =cn8Iy*/q4-*xX!ld Xqs BۊDS]hLq"')ѥrDܧ i~:COzti 8}n x7LoI)9xINQe\HPkzjblYzO)CNI׉`lI.0 +#%¸|bȢ:y 0ɜkrrsNV#JsXk+a$C_tvJ(==rM@n{Q2eTRv+g~IQ&HnB<~i4G,@BzdkrơeWSPh 9 گ-truCY}FRlsR.pxWwq$ձ L2]}76£ިE=p 72(s, zL H28tE4o1PV6Sr=P;lKu+R4GsJBe:B*H-{7D3ZAu)պ3?K ;ӻ?{ ՛w-;uD$yeˠu1/B ΅]v%24萼fSfƛ 7 I$hxc#ln~t,}7AkiE!:hd5zr =[CD9E|SU ͜8 ٓ}al[0?Đ+Cͥ5:^ Xg;=qfuui hS\v: иr@x"m iH"m iQ ZAm j 53+o>t.&OW'܄'z͉YNZVS͋6!sa hXo,~[Tt'Sf Qh}gW!./m†:0QD꽶Gس6傸~^dE:F,laTv鍂JSچ"’,JMX5{k%E悏s.Yb4BNcrK7.BJ$CjΡ'**b%`xr 9nUa~uT=Ihe{LƨkKׄL!oc^S(]6Gٍ(s=6$ ե,f#>2Ӎy&g;2L;d8Kȭ 2pk >-,oZtO2a"qF/kxPb?/g ਠr<hs{)Mk!-H=x{t R6Ύ_!qgI 5sʉ 32v /082 QDA.Lѣv[y|+ %yuc|°䦆IteBfdj';ŸWn\jKŨ=`@$8s@ x^puo]1]Q d eBb3!P2'ѷ&b˴ TpEiN%֘Ϛ{$Sݲx(ʋ:@]@A8T:8fIsk8DsD_ԇM65< >/1h\Cx0Ó@|:x u =&I3k=}KjdDrta|2>]ePcb?̃].PμLRlB!tq|D٤G2H/L]><4Vՙj1`m2G @q-f -W7=_ oUT9b~w냮"_@>_bU~~e2y4;8聁"0DZVMru$r06z<=JV)%?bb[ښۓXӴ9 .GI~紁81 lQ>uN (f8X>opnȠ01&G&!{|S9 n2j84!]T!|Ww2/ymN>5:3I hGv;r++h-r&iCRY').^Jz_sQ0\xtM3x@X!'a܉ی&hsIlͮ;K=E /HN n7>'oTSmG ItvT.'bg``? pb\w7>B'h*[J DZԶ_32x*s{v4t;$ ߢ&FSe]v;ԙ\Pq ӻ=އӣ+&3&;Cm4Pֵ:t;5 L-XjQs_Xڌ[`>š.pnKj-Ւ`cƙߍA\@KcVyjXpF7;3idXg4r7cg5U]&(L-ӤЂJƒKTkT#kyu+ 8(:$b,DYňZ.A#A)L&BJ,/y j |yIJ X88_uK/P,j8`}mV *W< 9Xy`ՊnfI3t6Asr;MvF %CGS[O} : ]n[@8uat R3 ebg6s' ;Yx[1sT>+*c2\UE{ G}\gu`33O&M 5ѷ-$>>1972. ͥ(Ԏbʩ:U23y;dؽUܨǙ*CȆ k^)f5lTaOd4j~jmm-.m󳐃Ʋ[_IًtX{!´S1[W?^GϙXb{|9R _Ee6Y=$ D}"89b*H jwᚋ*uw]&Ԍw,r]}Fa3~? 6I8=UGjU¿l6Zɐ.A=h$yv fYngL]-ѭT<11< HUB`ǭMXNVN{Y9]xQ-!d9@QKbeJMH9b5e!ȧx*ؤֵW(6m5gyō r FQ+Vÿ$`m%<*T8mj~Jn.54i1-O*2&ٝFuI^%,xvWj/A &RF7e2dOL_ *;d'd<C@Kh rw@cAY 3ƌfȃQQf꾘Qό~^6)B2dʨ2ڿC6d'dB~Bơ֞/d'dL P_~BF2!ctkd BuVvCF5dd Mѿ!޺7V{bF3fLaF3fc1֓1cL1> 1-՚:[paV|5(1-iIV 'z'+_Jf-Ë٭s' 'g}Kzb۲MNCk:`Vz]tdh0[%c 8#X/Gk{k[fT 4 5MizvjM ]5xnћF >&$aJ!L]4OY$>pj?"٢~ pe,n=~.;ij ~&!lݎB?K-[l')Ldpps4cVkeyGLIϾ5T-wA\\h@oirr!):{\15NRK߽l <77sZuOLM }v`a9-.j8HPzW]A@SRpHIw[Pwc#H]G;$\oRogdE{.JnL;Ԕ/,rQkK c &Q{&d#55vǰY%; -YJx\>2[K:jBi !K*n1SF2! [/V6NgG\ ]&=58NA#}EZhVs1JMN2NjPTBq]Rbi %%ڮneDPCi;p2.)պ_Qqi5zᵈk/Ƕ0DLGmH2SsԔbD@.mR@G @! E+1UT%4Ίyj=VQ%C1G;HuRGCtɌDcB;yMQe尗,vw<W(j66TF?ƽc⦂7B5M S[ îRaj.ew[PˑZ5-%,>ؕq~Ă(̶ ȩa aZ=2s&Rhya)ħ11泆K)R({H/;7,6&GHILW);VY/ւOYJtECJ`, ʕj75[e+jiY [6-0 9Cy5js|s0_RLaױ?1M. D@yDcՁ9p}ggp sAՇ0:}Yy'4X/Xz#} ]@vaޫ 8#aD֖A]%X.cy2 }=ɍllqbWgb K+<@Z=|,Pw^@knxC51TJ-vX|2HY#m5N8|U?Bfhq lecIe5$c (TklVj֨ꐪ=+pAoM{:A1Rh˺E MfٔNދ@kJo>^rz"2;GSvnK&`7X0Oh!& ])3p)rv)V 'm | Ճo~dyfAB6\_1o4hCm:N!YV!΍tL ?M (y:i4V csPeBhy{=P؆GQamM(m .C, 9h07i!ySEǴm6\\ȶł3xԺ!&wN>gh Qk7Q*gjtsaTe3G\cn&ZYR1aeK4,}ps/T@rPHB sJPօPDM (aTFyr{MsQԃW!eş`_+RnFSa鞋P<-~$f+{ jӣ32OEpz³}<&*A-<n @)g˿wW,[ս*nA@P>HtB/BD"kbY l'yJ]yscU! (i*]XIoOU88Ҭ' /޴T&ka5N 3"v(u<>Mih!͑@0Ժt֓=#&MIIɝkYrâ 6\9^H`Yqb^IZ=#cCwԧ{73B;9dw ;rc&]Z1+jm%;@(< :RIu oM7G*Ce I'En*UqݎbӢ 4hv ^_#4oWoIVsPqNٳG /._$M?|iv0N )nFv# +Ԇ c鿠 x'oP=5gw]2_ ZB#VlF3끂N-~CUB ws^7$ٲaUJyޜmC4H1=b2yM`-w,t׊MfW2dnZݬ^s\bC]+ O\c:̉5CQze@"~!UToR&cyuK vxUgpEfJ^ܽn:[IX¡|__Uˤb)[I攭 gIYF/S&` Xwys, 4[" 6yTX=Sfx~Qh?}FZv+F@[ϳhL'y4ͷG{{dei>xӄō8En@r 6~0h:V=3k6ǃ+=&nܢc͂(DϗY}2 @@-jR_ۦ$mwvbr&=f00.ˬ>~aJJ,jݢׅ/Ւ#Wr}@$[0 ^0E 0n?A櫬zl} `0?&^o \U?y+bÁhK%fʽKD K':2*вiU0jc] *\Jz|Wĥ:]^;fnc_u/[Z-]O,h ©뢆; W$&ZDK2 U-2Un-AeKbgEQ˛V|bśWѧJ;V[<嬮pږK^5ƺU] J^mk4 C OetXR=,Z$ߞZkЇ\!OW4 !h`FRܴ򊣬oϿ΀er04 /e_,M2V ]>׶3zX ED?6ƅGbzquûוMxU'D (cf<[n x%ve9)ؐS<^YT?$&TJ!&%)%iK ",ShE"džq=`*km=Jy%2}%/VE@cc]Ҫkf1o B;fg;R|muA*Wcle zڹee۸*Qz:AiP^p*:=7d'fBxMcLRvJnJ=JOD`9JbyX3sXw$͹=Ue~Yl&< D\䱡_x-I?v!>e)&RT:;*Tr&NYg&K~ܴx-nѩ/|򫎸[mфTAm İS;sץŝ5 FdlaN^*3q6&i %jCT]%)-euq\Y/v Nt(6u#(ːQԋ oly:'sɮY/ x&֠]jnpB:}xzĞٿ/^y??=z#ꋊNs82ySi~ӣ*+9X& M -|_$ci Ny?=ʹO ®Ϗ|o˧2ZO֡H)9!80*b*#_7s`fo;{B=ө&Ӗ`ڃbcfD"a`ъ9Thh"Ce0_ fDiXHWfS92Pau =tT5wM~4xgӓn)۶;{kXup55S@v0nf2=$}[Gcv^jBQ>#&ai^"׌=?29;vRH'>;EI@[XYڸ.\.=`g"*F 78XXCՇGQC$-(3'RRZ$8Bbi\q8J:K/I Vhzwv0.(,m Ӓp"֎ ,s =c]꡺O3hRihMh- ϫܸrZ̓ꀖ IU+ۻVЗ ^e&[œTUz'UP @5r/ٖmfb:H˩Hϙrm] Cڴc%aGM{rx~$'OC-CW>%z:a͡Fr鎋btbVW}vסOP:o,~]3exTU`#>Sɤ$LJ4H.mz ۼ"Un:P&}'[YIn/_(FӒ= U0a{)(2f.PVmc$PJ{^N٘emc71YJ^SUu WէlsgP~{3%8W{RguwRe'X",|*ڑs٤msf.~[+9!67.lmm|{h%[mX#СQqC5!ORQLYLb&qGrǫScU-4ٳڀFXtx@قacDV;O0G닢"Xݢ~B=]6az%)jmrwi;܈7[A )S8,n 9Nu8j8Ќy,2{ jtb';RaPПOU|#0 B山=bw`r.GLysyq 8lt9SX$ekj-}1\YV4;mݜ>D ׭ޕ$B="܄;ɿ֨P Aͷ#pʾs8NvPi1:v!~r.e/{z.sW6wy,"H$,TI~Qt:+>L@|#9VKE.8r.ŵ8@=$Jr#;vާ s:6 &#|J%o˙CD8WtK%TLͤ@Z)}gneΝ4?oFMq_ƍQ/,5;p~eu\$pBBDRv`DZC~+h1+.@ݜߺuǟ?]锻gt[8ʤWdmkxW0=XT0Ίʒ9r= 1P(7g@@^BBs>޸KlS\esL MC#JW,b^mm* O0ьk H=3EH6/8wkL 6W-]Ѕ\;8yejl Xi:!V4ybs5|jiK{Wk"ޙy5V8eCMzr#[/5 ֭qNB%- aD~-)\\+XZMqf Sexcߘx(M 2s̬}g{>^XTghF?{y*wn#^܎g)iX>-xuj,]~9cヴ r†7D>"J [AjH ad"]S>ABJT#e1s)\{wlF4-LZ\$"Q[o5sd{݈3H)4Lfn-%1oʡup5N7BZfA:fwo*:X>7ꗲT͋gB쁞p Dxل,*!a]^@C*vv>FՒDsY_64jt7zz5Ì$eNN)"B{'~hWC @WhNq@ꮘQ6n>Bh̻ +\ ~71ꡮw@%NWR3|=(%/mns,J=ǀPPPٲl5plR:;>ޮ zӎHB`=SC8Eȧ\"j4֦Qm1SC>#O yb;$Wga^)Pq4C*Am /ːc{0|*}F C+~7ɑQ5.a[=dd-WO鴐Pڮ= U|O>@gً' 8+Goҽind| =ՃD%U5{T ˟ kIݹ :צ&`ñ[:AOQ8N-T+Ǘ\<Zмps̪nm.[|17-s}>aԻ3*$QL#;mmdhe,G?22؁azU6`9YmjS5v+}mc3fKFٞ6_GR7WfBriMEnA2&(y8`}+DޫMfndyO"s8lv#?nר5O{#L{2hG\kB,8MhȆQ5a DU<5N6Fп|g2VY.hؙƶPbipWMltUX}Ħɂl3^L^ػ^ ``n?vq>ۂFgbgVڬo}&zŃdeSh3z} ۤ&]Ԭ!laZ1(fܭR lŹqJK6:Qv@GmJYnsv1a>i ͖fUiQd>F SWGc9gq=M7N{Syo}%ZY3(hAG{*t!z:,? )Mj*w,~OxzIoz` ݬu:wƢ$ JfFVи$4;F As>m jB8sP y#~ₛ;5$PYy+A.xGig*hV lv~@ Il4-P|Э2`lml- $}x͜^Δu_û/Mwoَ)!vxHx~>(n E՚ԻmŇ~jtÀnP(ބڍՔ 6N/K= GہڧΠԆ>Ռ4פ_K+yQej9@3%՝eDZ!M<*]D&*3B5Q- B}v{LHNvbt a 0K`R64ZJƿsZX؎Eh!,6lL|3fefqdRw^7s@y*9^Dk7nD!^w]JF7;p]1:-`IC6>?8H+b#$W;Oz( \361,o 8pi/c14Pψ"&H9#b&_1n③Ap$\o0 UPoufhO2UYFf_M -]<2!^2L^Hǖ^RITo֫eG+Հ᳡uX#̪Vl,iH#;֪8u)\[ϪH:^$mQ[pZweumuEz\2I!RWp:͙ZgfuDdW*jf1;/[ P΃tɜK3區g?MȮ⌇/r/2,|Q&7Ǘ7_Hb/v1I^L/-尔eu3"{5&ϒ)ehDf+JOnU̖f}q.~T8I*^[aK!IOC$3ʏ2.[;hX.0nՠɕ!̰ s ͰFQSw钵ɣTi }ۃ9MlZB4M}9!ϯusl_g>G4 #w= Z4@.t| i7q@] GLoa:  &>a׏n}@ø~=Qj[ȇKhO Ղ\@۵2,IUhO5E+{Hתf?Bk|uڒyϬusbK̏ KdvHv]PSr[@6߻Ew%I/?g*ue2+4|.gɃ@K4O?D~񗛽9!68SϚUX/ }U\UL+h˼Kq!@Y1|]*#Be-ZT( .wCm7Q(5Uy3 ʼXWz[>|y%BpZp=8 ~ by^\6@'<w~t)VrVW5PM~oi Cn΍VRP ^eDe^3IpS] Ӫ_oWAo5mC ХysoԈ2"W@2^T4=M1M]fUJ6KYy^fGCGdpl33WpܘVF^3whfR]jGKxMcU~t1 ֎#6i$*me]H,Q~ULՙ/ӭɳ"jEV\܂T@]fnvm\zX3髟*Y{]/kvF%A+hў6Ŝq7Ka25ɩ RRTJ[ɒT%%$γbqEc!rcΣ5-; Q؛DO+r͚/*( f ?sGR!IdCtY$'2R@}\nZ绪gǵoŧS+uHaLJI̪`m8y#n(̼$bm?mb#|Tz(zf̱JBpAzE]F{˧$ѭ!;OS>+;#0=Np7\+qI~;X|U5]I3hqZI*oZ=-RmVNU:{x/-ox8+[G;,ⲒvD6g2V8j&cZuG# ݘHZ7|[ƽ ԹW|v+{0䦕K6KiLjd0YɳTV ޾"@JԾ>!rfi+M~R;Z{O~x lzDwp3"U[4Ϩ$yY_ۢ{X[;ޟlE*@pUI,*.503mEVoh9R˜WdB:)m1B*g67a%XRɗ؃F؉ߔ&8`l=Y&]zUMVOңZ[oZ48gJdl8حLlX⓸W5%` aU Xw[aZHf./EH)Fx0*afZUu{kѕ),M1ĂUƥ')?m0>_0Udt(g>{B0)VFMQ03*r}SNQRHhKt*deX]*VT!e <"ʬu] `[ ~H)C]l9CrI{|[+EL+~ջ|z6{ 5m95ݞd7+:#J6cj7?Ӳ߽oįr X735pOV$qY7/UI } ܗg n`0`2:4 nbNҘI2 g)7O"h{^RsF76ĭas#"f9M1{\ K\Ӫ&n%lSzAe/(sցgNHiUr7Q%%>ZN*ʦh5JD{UFRwQj:3`5'ު7Oe?2W[~K+'X:L,h e/\Z-_e󶇇-svSѝmv z JRyD%x++(ɬ m!id\=ɋ,FgIu6#iJ fTpӧFQ14\|%ۊ;M=a<|iY)khvoz@ HvGxɷ;Q"Y@cn+UoX)%^hBV\v:I=H.]Uf[+VYmD/'_ wJ/RAxHOŷ e3bAG~%Y;ߘ5V@@4j"JT z+5l7.%I5LKm-%p̓ G4#(pO䳝k(fj勉^'#b9$(O1YkP#$\-BhMTr? X5&f6 [18NکFҎ.#xx/k_J)hF1 )T M"W`] BAB/ 1lMrd&]Q6ej\B$Mm`I,}ޟ<$#jaattjB̌A-8r;%͢Zm)ģ33:v,p e S|H% 6Tҩz&u+?ktLѯoܹwDN@vT%CE!AE%=umuoh0\D\׆7B&4E>&õDA^Zhܱ #j}×ᾲp#M Wbܺ? LŽܻLa/c!b]B[:;._mGт#$aU;9y+J{fJ7IJS^;^ gwjvuPU*MC,b;D8.u(35 (h'^ Z}r*$fn(lX Dj ]rhWk ǬpN7`*Ezt5xbPYE>4QDQ.fBl(e.h2D٤*I]5xDpwkٯ z9Vj ,EϬ<0R($<q|PT쌪PMl Ybq z(:֬oQs_o~--˖/WizbN[Q3|=)m|epЇɼ}h%>2>K/(jy&档6۷P #K|5t}M`݂62u,C;òln>22/[> KC@sq~2U a9a`8TY)\S 17MY$jXԚeELϟȅhǖ"EAaCL>so6II \)MC DGQ$m 4Yߟ@>p+ pY]`Luk1S*ۓ"PRF7𙫰(gc$66plrEFFRoMhPRAJ#vKCDv:7^N0A[xz/2!zbywK"68-Wg3.ycBbPjZ)pSïL1ٖ<1ҠʩbWY7AuUrڤ1Z5Va7xb>jn7 &z @WI9+*#$Wl~?pw0*SRu-K6kROXb=8g)D)0jB5 ]&b7f >YĸynPgwH}P͑D Pcb\3w$. c >̧|}. BqR$Kҕľ~YA|H+7bVpҦ;YaQgx 0X`. hw[ySJƺ܋8rbޠ_l'cccqGB:͹8AV/Vv}fcpySk$^wf;3l\`~mr“f 'y+1ğr*?-ِ:S[n5+UГv_+ux5h0̌09kv/6)R|*@M8A_0xzGKޠ&>9^Sey?ifd%QADǠ.C돮=n0465Ɍ [Nn1?s` z`H$C g6 4:'s-͚ sѥ (=.)4̴`=E݃+Ôg,69 ¬f}v>4͔v|VaU, ]1i *,EN1;W OPM_eQDyjr/n996xkd:$깹 =-l"_(DBҕ3 #Ot X5EB`r9MB^瘉6 i}oښi1S3Y#h^42"8NԐBݜ8ɸ7}}SֶޛFۅT8ɤ|R"vL3lELg!ܱ!r}k+^y: 87oyF52~^ͧB DW@%4Ϯ)IĄC;&Q R;6!L@q.!oHl yG/NPp*TlTupdSJ7F(ņXbp/Hp+z(LP0^1 '$ $Ɵ CB7HXc/ Fze6Í.h7э#."ΟU1ޒ xtjSasbV*bAUЅ:(+Z>LioQ%t.]E/P;X(2õqN5Ec Oْ e/!e//:aW?ndQ~*$a>3'ZPHRKaNyfyOzT&{^KZW(ƨTžvwLQDihC[m,lul{`Аvrɮa<E`on+t/UW)Gy};jV M+p%ǦzVd2,ed9XIjcI>U&ŷ]!!R&늓^s2bGYB$F/Nd(E|bO9zBG/z{N5 VJ3+^U2#\: \V^(ExQ)Z rAKw 6$VJWD6cv/s[.'L݇ T{)2eUcϖztx4UH JS*`u&SpyVrFq1MX!B]ΰ:[xLX7a؃Q,@{- +p-7PgSQwQ |'rcrb? ƛ &fqA|`<=]0!}<7ȱ.ͲS54rV+U kZ=w=qeS1Ϋ2ՠBlj0?ݡ| MpѷzsY~9a='[+>5?m(GgjuS#mWK9ʻEQyFUe?'eO|}W/͛}cC8I&EJ YA#CqM~(JeWR|RFFaɘUjQhr:>D5߾>t{620l`LD>1Ae {X%]ۅTPHfyk2Z;g תWn3`M>zBP,G`L"d\Md{iv#I4_'aagV {”ip"=k!s;YswD1 {}]ә,DNgM2EGbt#`)kL113['!39 f]*wL lUy=Tj%u 9@h:I-:5wbu""ƞ9yҋ1-deZ1%}_"ALHhU)?@/M4@^i;QӶߛX6k}PwϔƜ'^YFq>s`E{x{JiȘ9eehPOWK$FI !y[/ kssPt'NLv9޵ Xq؄Q:hkTΞȸM Ja)@U!@w>6L75f] N/ 7Uږd5jZ{!3Wb q}z/yjJF+ׇMcoN[X3JS(ǎ %LγEBj#lS%,lʃUF`Fwmuw[rS%o= RPvJ8%A/Bj 2Y48~^2\'$'3w&Tmo[Q~{]We^ll'_x`HjsSfqHEsm? ~>oi@f:(\'[DB'DNjڋ" bC7~Z矃»j`FKg39S>BvDSry-0:kb ~ 4|<8A!̒#tnbͮA-;H-aL k}+](ťR:G5 \"D3=shÅ#ML?ۃ=8?(f:O,W[":|KXBۧ؉kM$%ZBlI10?CeeᏴl5p2$c4hI=Jvռ*Bo V7U$m}+m" \ŴL 4̿TpB%+ s^j6w~r4h(-d;Ye/m<ӱwr " 2lG+MTI~tʕ!(yL#i'pXYt zCDY&V?/@]Z+)ҋ ivvb1Wu3!Ip|0Q&;gBi={U{dS+OA)n9K,qZG4fzck `zHB΋9:COKjjVF=>b۴Ţjd dujbj UU5| ]UnY}eUWU7.U/mxw{l7M]e4!eHH2(ׅ F Pյz5|ə۾qMlgx+!(/Ձd"M0QuBձl-u30hOrD0F-9{K̅Fm[]I@Dy'Nu&!`fy$B"BAhECydۑ۰ym9d^[ϱ$E߃k5TV9Zi eu޹ # 09utwʐP| (e+I\b!J4zȰ20tlϛtY 2s09%(b ERΠ}_*r|ǥ<'DS)ԁ[!~,r,-:O! z~w9[[ʃ~YVCq $_,0-r2|&&!,1 qaCdgyF558HJ Dged1mV9]F_p]/TA ɢkRp3gbTZ*\f]CjPZ0&5@.$yH&MǺ۞>XVJ™RFs΅")U?fE'ZPh-[S0uȶ)7(Tc`~:WlߍUU\Mc3XHͭu%Y7IVWǔX(w]Ygohh2ח:#c3~-*Mɤ;Z>lˍ<׀uS2KWH9h<8:DNVO| y9f7=٢Kpr:GDF5{΋?j}ʓT+ɤҙh6L7 e|p:7̇S,MٝRihߩ|x&&εkfn/^XLnhS d%YCb\LBK.SS/,C\gUp2Ps}dҏ.,Y/1rCn' .#p2F;/i rRZ%-cZ=j W5-|IKՆ7ިu^ӮZS.zPR;v𖭕#E%* .KCV2M E'䊼-BupV$hIe%MGk]cDUZU$ჰֶ EfB@!f@ɼ C;yDVU"(`{ klVVO=%zs.q/dOr7cfO6"en|IDӈ5e@YyzOT^MQDԝ|dWjJfcxOi4G\ٶlsغc2BaR˄y,3_ē+Mu5Q)kKS1#CƉxd|n@\hza^AǠ rko<ᶋ<w+OڼM4џ '?](k=LֹTcʻ#/QPg&0[αH%XmvhOvNpyed88\-r55>_& |tLss\+vJE0 |:vjq@Mh5Z=[W}{94Cy,n|3*][Bh&p,K:J0GK, ǣ*DCc%']#|LoS`@ xMY ?7QD&%4"*J{osvavfqivF-H,u_Nx8`31wy9 irFrCVWb!nrd *'̃& &D0n"i Nn.8!1YirصPי3"i4̃gDO{/pA6 p3_B64I&Ió!&zg*q]8 mb\~ 4Z,ƃ&j^~$4I u򇕽1<[."rla"rAc\4mug '=HfkfRLr;kATk*&@?Yx7%d-$ly^"nhHF1JW!^>y!IaMZj%?`|0SڶKR5 9Ʀ*~h)hTUϐܮ^뫲Ǫ뱹OkTm|7=K*GHQΗ#%rhZ4 lĺ[_e}L%(xxO" MB^?2|-̉=d=d,xi+އI`&OG3,r/Hsʄo*vKO{ c1ѷU*˜E?0xĐzP6ޕ?o>hN?٩4Uz~k<ϓA;KW!㟱%݈v|9 jK㉚njޔeȸCdU7bMd7ur_D7J,T}k27rƒnU#ʭkd7"gЅ;[X"-T!@gnKc?:uTɤ=s@6Л+IZ$IqOQ ,둙̞כTaWП$Vg5`N 3dCXO!ba™"Q#`8"zt=>#Daz=lۑ0v^(Pװ˴KiymWw2Jx2L(7vBEQI{Xxs( KOb ~W4|4/C$D„jq"粍hoGЬk'|ÿnND]2^OMWuW=xQivz68o`(Yzc/ H !`˔ď`;sGHEb KϤ|PfT޳Q sD`];bY[9&!Bx~12:۰zrpthQ<;e* 7ISW6)"ڨMɨL> 5.&Vpq=RdՆ~QV6}1X ^}9æ=4 j,x}^tM63ɦhmP6A]Opú"L3VԝatE&ؙA5b.%p؂|cpR[2 k(%kJQh56!sUK;آYguJk2Aԃ1ezM/D=>[42oU>$Lp0v"mMlv'C-cylz#Hx/]?poz7N's9]v1ChnaVU9,aI `PN~qר}.}>x\AmoTkc݂QG;DR% ˂4f+q8^纒zYiT y5{YfmPE\H˥/6l~nkd|\ei ў@!6M2$>B(4CM6ԧϽNFPwz콮@ %4Z&+SZxIr=7"5k݄%Ze8OM%|.f鄮D(nYVA UlLycaL~oEsL ] 1nK9P\6\(.L/> \fX\ ƲŦZ0ݤC^[TJYT(Ux5_QvTT;#ʙOMX;ak5.*:Dݤ'i\@i'ch|@ jC&'԰u>6 '`švPA?֟PPO iw恴DZ'Ԏ4/{FZ|Bm>@=&)v4t1 (΢ص\t< 2Yqί:T@u5BmQGmu"%MGDˍZ=RNהUg`V>Rnߚuũo_XXe߰CjC7 ,ov>g.ٍJ) 5·ɩͭjߝIDM}otڏ)r⼕'Èd("ū*[ySB~Q7 'HGfGوr&?5)_޲4'>Us١uȱ]KYc]Ahw.t^ƊfxDZgd!^wht&+E+bf3aJRz˳E(ȸUV"5CUgG^Qa 7 쟱^k ԓ q!Cs(!͂WfyԳ}uy^oreY1#3L`CO6#&^3@p-Kߚȵ@,1K0YeVvv>PRB,-u2B|WlE UU(^(a)Qr*̇G4BnɂVٔfg J< ~_eLF!30Svu*•k\IcO^RF3ud )9iwM⌚WQD$[Gk@pR Ӝ%qT$%0Ţdbe>/jyդYvyVQ06֓i?IU,Knue4#w)A AS61;CpW4v*X ' rV7TВ_șjxKcsS7F1+;5*΀0W5)lh!o%|JwC/*UH_UjTUы Pb(&P bBku [Ǽ'(n8^L8}EO,@\dIWgXa,6Ѻ'z+EM<~kPFQQ8SJa~ݼK cUV.-,< ׃||/}΄%Z؜VMbKLE9oY)2X\Ede-"+WKDE.@fz[l qr^Iv4Y.$xY%ECpTl rŁ~25dhj{g #5؟O}T84^ಭĥiLi3]Hn0=esMwҀ抑e%zC]]ۨ'}M flֹ6[v]T'GP%A]|/aj 'd,oSgQ\/ |#JM.#DG<ç=-;dX;v8:{;:*5uV1ƒFڐ+a T)V!S3Os0Z1K"KgkB4 5@Y0k@mC5:wm'e`NėxQbQv5eb]w IV9`\<{Kp`yN;ݤhxdZOò ֗D& |)djmYq:Ac Sda SI%FQΫ )R_"诽hb{#)=iΔg --!#Ic |EI$w.8ǧԩ f$;{F[:iƾ4(K{C>PsQ.>kqS?DY65W FHBj'{xw[[--$^.,N+Ѓ:<"^ŮL=#On\& !spiۿaД/ѭM$vcEnF9ٰ%u!JoGmaHsE1V e"M{n]={*P-D3Ɇ^͸to*Xr"(~Ma+#?St$&V}~c9quup9rr~/']N_JwA9yq+.۵?E =>x.)eNoo6@ʭkX5QLjA {E6=3^8wG{)XlNGe:Nm -6;@sKޢOWJFG6kͽenQ{ و]O>ؤO_~ }3ݽk,VwWE\D۱7Ϩ2{'I@8:l*y@@&z RǻEMܡڮjVW{y_r(ѳ6c}6U#oY2o]3>Rhұ*E=dں ' 0A_ׇzsnjl2YxA$H)֒êJ57>!䬲.n{m c >śC?jfB:hpK?|T+yoSnk)͏0 q%n{Hs Hv]heR)_bs*F&ܕfI`YC`wHO %GFt硵ȯwQ$|8`Yڣ-PgάLx[v/tRsWe+JDn'3YykxӮ.;R?ldnD .[ؔ+gramvȞ\zʦҝv`>5ӚP)E]۷ZtUi/b*ChzIz4ݺ_7kFx*Ziɭҷ=,_; Z4|֍YpS][ufL{ePdNUd/FeFBT̯q\ݞ}ύs_P'[BUT>fYi=hUag=} "q'՛}܌\5֨J7Puܗ;[?Ol5M)Iogau¶ niLjo_eE/TyZaWy%*\^Jw>}`1ܸQcQeS-U\JCviG/{(7h= INOXpO X߹,(9P.*rG*tui/:ŀEKF9P[_o^37ٶ?SvQpA XD~I؛8=xm3]rjwBF\R8}}S_R 3x}JKΡ;CL˲DÚpGxae1^>٧\/lf;. Yajca܍Մ6fܧy5.a &&G<ծc޸K[Gxqy zbvjއ味 =gSb\y}{4Su>B2wARG{ {gfǿȮܡ.ay-̽=bȤ>I$@4w7-y^ӇGl hI\*`^>Mtan0Qp)3j?j +~~`[) $"!8-yӌ#O2^!8_U?xA4DžCU^4,L~%C\̈WNNf)wc'zԗX/).q"# ;(nZӵ>!B3ɌҚǢ. XZڥ5mKQ#sD]hu=nR,EQѦ>s(/Fl4#mrΘ~~-3y/%)%z{i^;ta yci:4$u?<jkԫU3P*!|aԎg!9r .Np 2N-R,qeze*mл^l)t|P_\Bb >rN[N_ac %{>t3ᐖ-&O(4'++q ?CrSM=ZxxPh163Ŭ"c䏓`0~ P=mhjMFQs@7aIBlwq)iVa$i卣\w#Tcpa`Ppjl1yX$g7Eu9xlxPP uG/7v#rk$CɠQ+CN|P ܓ:!߁7AH@%gKxdGl@tߧpzoP*%{I@ )Td40eT.,vvN|<&`L*IJ6HgLND5sCukm_oxm|w:ItRw+i{M=\_kLN\\ Mpv46-f(u)4f\V DxPZ_Jo,'ʿ|JpC~@أF0fG>* ʞ LA/OҷE5Iz,C]VR)VcTЂvbM-*JoCn{9ndB e^P+AY&TFC )ELu‰؆.j?Tl~WuX>|+<ldu.XS/Xw\7Bdzzz'e 2molu*TR.D?}?Ѿ.|KRɛEhRHjfGQ̗چ+ȋt]GAʄ[\(>Q-[Y,e*ozL4AdcnVS5`G奜ztXk#tOԽᓤ c 6Hbq9Vz>uab?GnAǁA6Ѱ{֦:S;|. /$Kp(uQՅMEolgږuQHpmG֜vCI=rpR4L-F@}LMJjxuxܪ0M<ݿIp! =ڲ7⍍H'˯{HxDًh˨reIH} zXνH%@/ZXR`7R?%,e V&((O. AhTZd~mBћ;7ATcueR 'fIO P4m@Ag9 Q ^[b=h{ N" @c;RV>)(XA@FC<"ZФ ck_me8}mW/_]_ρB!,Crx*q˻э,6/$4,Puhm.l8CIJZrt6V<]ݪxX-ѓMlW=="A{ݻ*ir"o8zv(XOlgFsB=26TJ".~C`sxɨN7Bq?@*IUb|CQӇҐ)bIt P#)VusvmN2al~kV'{[B&TٍI}: π0Ǿs{VldAnrD|V gltӧ1^Zzi)h/-Ң(o8AJʲ6ҽ,< Q:o Og7A>^?^ɔqt)6~p:߻k 7jz? 3kQ7'*SYt`rrQ'{q2OtY;®BW .S&<\S@'x6}; SKe}Q^9Ue4񐻾om~JJOM\bQ3BbV[K_=7v߱V]j%E8S-~W^dpX.=mNi/iuev:t;Ëծ,^LT•& cL&8|5:GY`Ńg9EmG(uRŲ+b:R'Ԕkprw,lqJS[oeqVLKĻ "m,vZB|z۝O޴L;w us  #: VEҜ K2mzޝӮ1VjOU? :ܦE}5)=^ ->b!-wsBx}Pфm],|FWV,,J)/}|5=-+|g8[N:^:Bjxþn0kTS>[kZMO͡EG {W[\٢[6C[~!l{Y1h-Ekz8mu',ȇ@݆mBf%p. O.ojj}\\@ZFT*D)w~3]Sܵ6]=2䥓kT1\ndcuq6]Y?^i].|pfʔ8 mgXް cy4=?۩k mojٳZ UÇB}H em\ okH Et; g^,ׁnsϳGQkrKvN4ӊa_wyi/[kκzs=' wȬx% BNϡIuc0[sXh`m)?+=+K_ 3cn:6}ޭVY (?QehX‰$H?Uɮ} _xz ̊.;ml4U i\UkX5Q 77YFUPI#xf=Ί 3@bnZgeՔɥJMQ55NE.TE ~K"iU@Z[HuU艈Xi%Z޷RfP_` ˺Q)lFIq<>g:q c4uX1 y2Tu<#&J w:&v sq}c$ z),J5ŞZO&NS{;C,P4'djMXҫ(}~V  < Q_J7dlVPjZ4ͲC9wmǰ֤MzmTbGV%;Nk"l{ m]NiۃԮ|7(O~eQ@!{ϹqFbˉ8o2M@j~# xǘd#X8G @)G':^BbAONu"Gˍ3Pp_kvfAJ`5QA8~_<]h5Hz|EEvKA ԡ?TgR1~5H3ղ'D peG{d * z&$@6Jeݮ 1}O;|r @vĬB} ,'{_\ݢMv#\3\n~ m"DiUmrN*ā|$rI[,1(p(ؒpSl]M Ӝ$="ԛ(NkIX?i9Am2sO=DWE8]|q~4At8Z iY݉-8)PǺ0(*uT#36(p%UФ:,4,<&S#guxzh6ZaE&-fڔLÏ1FbnYU T4&&^=F,Q#(=8o`XP|O:%g3{ρk~D2 #x!0E,tJU)In$OCY0֞3>$x.t,8*WgLr`K";>1㳑|khFDЏA[=s>M2kzuH𨞙m=gCvB53hm&ڛyN걐uS t6~K#(l$8CVcd 3 >!^Y/>i( sȃ+ Ɛ>G˱bg~K\'R I0>EZ//̻PrZu>.8Q(9A4PYxΆ{XO6g!bHx5[шGL|$2\[ 3cbBƯ~ߩ>sDP1a^"Ze0A=+tİ~!XrcYNeI-Gu%jwee,}`T,iFIMd&ffԯ=|٬فh-? J`ԭ?,Jmp H ; -!1if8$]z,5FթO}¨#1t8g'URr籠!5I ;V(%܌dnaK yR@}>މx g/p6cSQwhs7mdj8 `EO: q'BOz$G#{Bԡj.c6f 2JUM_tFP}TG:4 peI)f | 'CZ#ɃC-*r_6JFD wapfM.ݫ4/wIcw˭[@8AI7Ղtj̟ܭWd%NvN(Ӣj+Hw ;x'6UnNty@6B,fUIQs,i4>>8Z b>s C{ ڨ&9 bY0of"sE7 SC_;*Ǭ_iRוB%ྭ4g'2 E jzXv'~}ܜgZ 3'+vMz(j8juvH@. ܂B޿Ps]Tъd,eh1 X <51>-raOkc؇uv0GFw͙eq)R;znUlJ1`H 8'n*'>`͔T#EYm[ D kB ŔG)(cde̪T@*m熭F `$W4qfS5 %kK#cBuc1%-kozP/VF $-nFn*欎 }' >3fa*)9~}!'c|1#'R81̠|0rلxszvhVæՆǵϛSC TCĄ͖ R. iujiק^drF&R(@0KΡh bE_sE9„`,zVfcͥIi]]es A|P;6p.gbcSule玺~:uQgznҠ8HP))BA”%̤,e2UKiȨyuj|ï IkaRr k8%/ ZGDXZ3BeJ}[ټ -\ VHB&g<#@l^Zym;EPN0;ގ8Uf.BE[jc՛(&#f C[?`)> aa*(u<ŏW0hSEi456AnŠ… p\t@U YErh0Jl|uh7; aBp.]yY"13FC)`um|ξ jfLr%T +W{OL"_Bc!\u Ј~ 6䕴mW԰ZA ÇY66X%'( `J4sF3TX"Llx8"+%K iLd M)1q~^ds|fq̱#k~ͩB/ُQ4Rm`5؆7l z< s ADEWqN^4Y!*0gH>R hC߆SMQ&6IAJ' (WNR#ߤ?u`6]<N f2 1Ŝsqc׳+Vd;uKAOqzj {ϋpzgo@t'yO&2Ք5n8d(ӥ\p}u)2$X(.%kR^ZŸv+;%3J<W1AKiJfJG\5<U sy G+Q/ $4'e6)ԧ.A00kIEDrO^zSrBC$ Xj6/Vn}+n5j| UPPtzfPKU}ye|na ')ИoXtyhjzuXWWֿe#i~\cxGr[.@e6:O&U!/tpuQj^8a6ǁAkT򁔉~\yV[CK9‘C T/&>s3."ÊX`]*S,3Z'yA!jm {bI C( I3m$5S]bG;po9óQʨheȨC ؖ)?mU3p6Fw0}hS<?gtz f~O8kc֫B~jlDpJrS^"U#O glzR)-zR᮱ȑ\9-_%m]/l @m-p胝3%Rln&ۺ#p6W0tF%pTWC~ -mT@tH.NO\AƎ`g 8yW-&?0w:U~DU8د7lIAq\7EtBI;DD7z* g%ZB>bɮO:亂$TPt2BIyyG/hN6|p vJ<Y}H%'71+Һ$i|#4;!Fyo+2Gɝ=j5ɌC:8[ fcc[͏ NǠт%~ T= o\W&CKK(Ky'=w?r׼gH^Lk 3!__K#*9ӝ>$a?l4qvո4W ^[Y@2m\졪xvC ?ȿQ16yD;kLuhf WV^~e&Ll<뇨qT=nT+G:_+uu8x|f.Mj芹j/f:dKHטO<^в,#d:ߝwena o<` G˽U%12v: Þ Kvk"^(ՋGG5%0O8eԆKw4qZ_>ozۂ14@X'SW8o[ms@Yh(dR?Zt*H^6THX>s<1-@v#TYK]/ղ#qjyX ;"2{vG&-w2YUG^{d[GXonD*ʴ׮frDvHNw3pkZ&AP!Ad} ~5[*N2"&IHS&{..xOreQw%R('>qy/^=4r*R9?Gt=Ljf#\1Bmc9p(sLb =u0n({oR$ӌD3DTSwZ.*4rDmAt.dm95*Ff v()wᙑ@@Yd0IXmā"ŽEٴ4fMҕ hzWSʺst1-"Lus8Rғ&+0 Rr2rT㤥]Xmstp^BZ7F1Ql&Rrpr|MCJ›J0Q8h44^9Nb HفcGֈn=vLQWx`^S39b\! ^V)n"<-ˑ~Г1ix5Ƿ]fv<0⌎Z r4sd4qͨZ4("Ta)J&@p+E$IuNE8S7)MsdSrM;2\7) }3cn&B+5l nd7u 8R_ͼg.dʠT _к+W[';bYBQXb'.C `?&f%;h>E<;9΃+ⱜޫyjkwg6+ Yia(Ea`^bSB:\K z)=$JL_N6.u%;k7O/Kq6 !w?"7b[ftΘ[MkDm`)7ڬ)CXMfs3*5CU:)l֬0 0Q!0Y)h齌+7UubfA`@9ۊP@}r@X__٤Tpi~ۺXP @9r@\Fk-[Wq\ϭ؎ X=n] Ȓc7.)Xu9DVH:\Q+Մ P[ad^Tc0P;Ƒ˜Ԃ7ǡŎ9yg59͐/+;~$jal~Gԭ_j ,|9)+… b%fN"r VKar[B6n^Řuυ[.5$?Zz׋1B"m$?pyeXk&K0*wa"oNIo^X %@OC+CXv!A{eeBQev $UYS%A0 PQDh@ί"cjoɲ -!qr̤l~¯ϜsY+}OZwr)p].w/; %ؿ8,mNr\B\tA=WY} }y?m=oBY,{jkûQGAK.Ԥ."o>aI:*##EiXSѪ>jٽ`Ac[?qS mr&}ltw?<i丒ߧ}9} K%U9f~/. ڛM=e<*'WL%+*d7JfPIH%?f;mIIYvRğ4 zx+'y!`h?F뤏%{'cbq' 5w_NJna?GYq=I wH٣0L#+)jvX_jq RrE߳_KprUںl,jפn6cT VLڋ{ T)zzOKPވLLÞ\MvפM9'k4a~kebj^k-զWa>i[xz@yl,\֝Ww᷆C[%1UHkP8i]=c&Ӽ÷>][iHO*;[ Dwy!| [&\Bz{#2YK3FԀ&늲Wko*_EJٯIqn@ zϑ%9`6XЌp7UGer.RvAi%ZU\cħtb] Ex.?y?}K)JիŤ ;_7.?H9IIP\ܞb])z[q٢|X* ߺVFW'>2~۟ _ch6MmP}84ԟBJط L/x#c蚝,qZWl݆h-[-6 bdA<3k#LkDznޔKjaNJ^̀ w\j'42fNeq~lwz;#T&V60uhAjW:[ub#=mf[&#@^/hwR|x%vc1[{Y$J*o]#)MژG*>»)sKwnílQf3QQ$3.c7܊@dţTHQ2e:9=HjVgZ^AZ^%،lǨ lηڦ;㾓8NʅFb6}7[uHx H5kvﲫMv5xQ:y1DW ɐNAܴwc[œYT˪z0Z˶PcP)$98 ?q3X0z=ł]q1Xk?.y;y'kz ׸pq1[uNP_<*A &%tO"A{#O4r"g:TwFΊTPAANNLjz%"u0"!dp!<Ɇm/k9\j?CyR\}؎WA)T1r()[/dkt# D2:Uynҩmq:Rx⵨/q°Q#'KMhآgo},x4g젬yPNVqi-urV]A:`6Z&'4Y ԀۍVZ0k0,_JoH pD5Brv79XB>5̇HyyqU5LNjչAqJLd=SG. 6ʋK61@SF z]w7=`20R̻n02~8}uğ ʾbGsHGLvICaљQD6fW.E?2ӐvjĨ3p GfU>^8 *W. O*>hxx6J8)-͏OO38L5 ~II$LV&+b $(c~bz0K+YN-}RKPPM^&Q A љA g>q=<8sRH?7<%-`Ϩ%br٤ K^ו1>'&1wHIb|6NJEB |:;y!qFэ d, pSH%#_,#/TF,GhvYv 5-e|/^SdPК}@F ji2IMhj8A+F"lW?9y56~>zi kBSv1 o_UE sBpsF۵?:PBUB ځ]Wh40} g+} wC~xAtp.n?_~}?l=!:&:;~C'eGG{}EF6dvL(x},tfǕㆄouƜ^%4kj7@ҙM+6:s\2xZk$^cCx\v&>[ ~ϝ9Hy=@uX5)h^ƪ'|&C#!bQǹȣ |ɐ^#\î`I:*5wAJ~xhJDg VV9aC|^Χm?.\!h ʏH9  9 4yA%-=/w8^7jZ{9Q 28}/1 Cp/DܖYGg@񃃳g#~wA4oMt 0 ENC~.hbp'eƢӕj9 kRCYG/ w*z^{ # F& 2;PqXwA8cP"RYfn2+EPI?Elv6'wV<&K%R.ZgAUV95X|Ĝ# K'6XGLAgO@N?L0(?nEF%I~?tl/ A!{iq>*HV'#140>=4d] 6F@C qP6A%l|hF0U \WY`J'o76nuD /Ȣԕ j/-ݔ\XM8ac@6 JFWDY:UA~=ng`m? h =3>s͝ ']3T V՟6pu,1C@%0Q@x3l: טZsBMB 䔓QKdn%^n8O{\L:%p^Lro\3膠w۬{icMWF&6ˀs_x" Rk5 , mZn Ϡ5CU 3}͌(^t\nC/w d`OZk6T-)L,,!l׍W$aS>A~C] y6?z90˜m8(2u@)O%k^0/'jDf[*nq'bj@ӬRR6h?1>L1p%B/^wmXyE g-s3Ӝ00.Qn(]y + 6 g{U&EŢLKd<_?e`z#,iJsŔ@YfM9)&]`B(Z=>4|E62؞v4u**8#779?B^U qcsj#b cP*+6F$!ߩyá f|c<#*„Wpj#BOFB ɑ i2ʁc /Rp/za5 ZO٫7FX(M{ޢuYxvL 3hjEb>ޣu?xXU^z Ft[}`$_jCy+4nFIv^0^BC r˄"7S*rwU0H6 WePŌ8i8d;.$9эLc۶|:jw@mƤ5":ڠӆe/ aUvg30^L0&EL)H*,= 0$R /qɌ kx1b W3,Z!،༶^@bzodl3L謥lIɦ2(bxp|cZO9^zòre^ZDtDPA&~E7 !B6ߢ-zb'52 T0Upυ?_yd j)|sU{!.Nd#GF?>-؁*;90El y~}ps鍢W N7ZENN M1+14mIH) NcҠ4;)p^hݿGG**ׯssyH1r lʖu B?kH;Ë64ejU!xAE>hA7iHC<'s˦VqAKn( "jV?e'JR άObs󠣗EQxHkr E '>޺D}7^ jԎQ 4_<~1"}U=EޤIѬ<|q,]9!)W=x nU6Պ. boVA( !TW'˄#5e74A#Tp ,DPoU7\:vc-mRu%#}}! C0nP_Ky @`*ms/{nض16EE)8rq!I|AWzT ){ *`d2!p`$rk.E"&_mԽ=B!rqr-#͑X:ld/6qgR_'Wb--dev,q1-bF͡b,YUT &\W^6#pkf"3\rk0F5)^miK7\~4yӑaN=~]Fc˔S[ =7U|]5jOH3˙yIXBkle4 jNnI 70EYZ&{'*Z#_H~kRO$fKnǮ@} >(~z,U\=ǪO o8=kT)tj[a)cL[rjk/u+rR)m2ڄ{z]?қja4LJxa>Yҍ&}x$;+mU}Vlzsb(F~\W-&ʗ^1γý^O̴Zn~4Q1ȪiJip`®C-5ffb-&.Ți)Kn`T29"L G9G}I$<3RR#jLH>fRM?$ߒШ*eqB&ki3EkZ;2A[ ^7>5lɺ] 'Kb~Gn;dzg2Jj +)(W:͹+m_2n3nSqP~͸JHͱE<A]ǧI@nwé]րV|=Ր^POUBs7ߝ.N:wf\T*ǐeBuus$6|p|3ڭ%/tu,wW3ggpV?0D-&XG"K(C~7)SFxz_[;t6e[ZDy%ܞ(et }KQi _Rvn9Ď%Z%u< t(껞L2ǏI]J%w`:&@ٯ>)N_)!1 asKj73iϔz)c2+n=8mOu#Vmϝ7>ߍ$@ZK?jȃ ;.wG(P/ED␫)y:V+2 <1mHZb1r{RApZ6/,4I,P@|4E)IH'x_X$[poQPz]".^P]a܎uLzeKdMdkߟ2vE'flDd lDj/"o3"mY^2}K*ۨ)7{>']ٕ:Sfĭ+J)⭨Ȗ6JJO;6S&@0ڑB)B; M:kZ6 m* vPh)CB).mZ{[u/?ɬd^.2(бaǍ~#x8+7WP _3f+O_0.a烰Aì$lA >=!lO]7g`wgpw¦3h8Ago1؟zYAfgh \evGI>4$U c)@jnee 9O̧+7l pX%c5` ^m5I 0-aoD\kE[k-iXG}UZNugt%OE%N{^'|)=^ 99L] JUCYAr`km)&3嗈GҧJVBe-ޔFC6`<9aMzv/4Z0<Ŭ2Pbou;3+ \[a3fYY\e9PiI=YqF-S^x>࡛!-{.ӵ\Psuhay%4zmrJܓ!eWMrcyjR̍h+)Ise'ptWzB^)DaQ K!V#ۛ?ʉ\[Bu@b"ڿ5U7BjtZ2h7=ߖy,,+ۤ8̊ ~6c/#؃j I%ֈ*d8U6MdyU9l,M~E8qg =-,>8ЁYAG Ӽ{g<"p;gi9,#:R:59;q VXܠ6"m㻕0<~;|\+D-} dpvZcb/ ]X(Dנh*sR|}oC.S.qjѪmMA^ܯ1-K}Qmeb>29γ>xkNvQ]i)a:| gkX+di6ND*(MdU8-cM0֎ M츓rz㪭|Od/Demfʼ,2Žɻc? fb>ևM}[w}ڲO&{BM. w'CdrS9t|(Z{Bo$Zas13ȅSAZl#٣ci!8ȠcJ_l~^?63$ "0.h}c҂"Ü s@Xd͈-Ť4by S# l!oZ٨mpzS|'N =b\Oq,38EdS:B⸢5cfQ8.ֆ 'n #z([%nLNE/?C'mpLVGO(yWzޢ3,~}l)P>~Y64xg_ʍl}rI;OҎi=H"m?H~"H~J+)۾l%e[R?(c`xu\|F_YYC׺k|;_ 9Z\VbIć`r?d`(E4$(k5NSZ*4ȝiZ|f[!OCwM5͉ەDn]@ SA[&BV:+јҹ36{X1H : םl!#_>ub:f̲;bůReg?4^o62N49tbMu]˚Z9;[DοtYI¤%}r*?=Q6m$LӻO[ V1c*rKؙh>ޣ* i2_C& Nu  b(0zD8:xO*-OpAwRr' ,`w~jɖcŁ o> ǽ&"DUֳ.]ȄP|l"[ \&W{ܳ|JFԂɝ6n%WSlpLJs͑p2F RыhI3vEIZBc~brpzBn|tw] cyDe-O0Nx_QMc< M1I7{tڊJɹ -[`kZ\ZԸw=6Y#-Rnyo j²%W&vz7iwR"r𼼱P)K3}ZKVk-^b_A{z^EGWbyȩuڂ'e^#`xNo:ϐ2B;&Ȱ.0nIbP,PI[׆vE돏'TQ]L1Aхṵ|\őw'V7Z@7O Fm"!kPI*V_ Ô{ULt+^狪>͹5f )UG9B+-9ۋAN9!hȳY=(p.`bGҫ,֭h׫WKZ[OIBoj ׂ^G,y/a&]?(S| b{G n mɜUVͫj -.&2Qi~G7'r*B@Vo8[.f2PKc4=7/,>Q(c({_f$MLha::ťfd.YzҜ,zmYg>u_G?BZ_Ֆ KxM o8$$%ylmkߓΩkN, 7|,#h6)[3+˪=cTБiHj5_lzѵF?opzQI|⋢sNאӯPHZ A%iǞ2Gi(A+ ٸldr$#[=Vyi* B(aFˌTƯJ3+vvz2bro>R`׉"1*89eA5,]Nп9`A MT '?@! h,e6ЄC3~ /8$nLG 'by/"`νe, t9C4J t`@0e3rB'h$Gr@G}p%$d\ʒ!A8|QaS!kk5{,n4V* y"/p2>SpZNc~Z@4< #&a&c2.jߐXz"{K~, v|XA~+lSZ"6'HU=%S(&3)JuX0 }cʥؿ )afieQ:b0c@~ߏmT+ "n*\W ŀwFy(`δ<Ӧ1\hORHT]?E ̙ZG.|d2+w463wha˃'S²F?1%jcL&@5b,p}s;cq ɬ9򥬽#3^,Xj^ eIkI4zިb;|9u:l(!د(ՠ+ʂ%?񫊋*g/F7[*~v#PLl`v:i\]Yk;~G9__8?[N Eз8π:8{.kn땀 WGHrAA~̍7%v-EgrQЉD}  ـϒ U;7/:5 5K-&)zNoo|R-o흪OV r$:F56Rq8*i yRQg&!,^ CJ>7K3\/r FEZ#Ո d(6p'ԫPĎKgȷ+J{c,l gAh4 B&Rq5+P-VXaXQ~k ܥpf($Uiڞv6`}6ppYuSxSNSqW󌁹| 2+D|Wzeps+IٮiV7΅܃;U󤝜\>4m.>^s"2fjVWI_{ /ЦH?;Om`'"ªUV9w滐ᄴ8 5(@b;p qa+*M WWPy<(7'܎cc-fLS[$|{p ̟'-S}#$Sn*e5 :6Uw * Yl+Y/ |_34BF+?;'WEְ W1GMz~[  ^9@bD|fgG O5.d s&ChNRbN A/9ڨ"[_P'oLJՏR/>>/;WBy Fx3.g3q3ٻ83uơ~!}C1'Н*Ґ_(t3 Z,1 P*㐞qei(UEzLCz9XGHCjii(%3iqH88t2.7M횦TvšXw(5B#)a ԉ&^4㱪{z,Xo7Űw(I&A&j,@QjPpR1oy -Du:w=YP3bMt ɪ"Q? ؒFa:=^ 4zrwUsfwV\U< B YYdX7&í33 Xd!& VVaAVѓsɯ/RK\J|U%E5!LH3,/dmXTefWnplgfKh0B'Ld=x9;of|-h>UTm X= ]ka ,/ g$9R7[=nj>,N?UW=,/F|ōglV{z V+qo$dIt%e߲$Ik?ʕ7ItF ~\XR#b3廒Դ 8> aוk'\QUY=*tޕ=fKvKU|^@xW.Jv.y[ջXF,)]( OP> ( fyY<*WYemVwelfeeXo7e3U!pxaew]͏VyW]-#" bQ We$#j92o9jzK!s1U&׍sI$%Q7EJN2_wLŏR͹ 5/Kngס#VU` b4I4/Ǒlzu IC򤗱z |LYPk% Yr ]vsj$g1ܴ5k;U*4K{4f) % |7;T~"2z?EV, QG+BRyoE+CtӲ>ixYyt%V!>%\vzѱcN++Mic`Nyϳ*Z[^nF6daE\KNB)9lɶ95m_sGp1/1~)?}<",U'ڠ9 ax, 䴝 PwrAs4zx,5 TcJ Bz_ٿExB}ퟖh׃dm6y a*PGR(A#Q:t%qRT㛃C!٭U:DD "U`bx4?Ӑ<2.]-+Ky{v6jIE~7ߪN][ 2aH{JKe7Lڛ@ +M y@ϔj({nf= K6BqUn.j/X8y G0`fP׺3:on~oKvcWp6~|RC=$ vTcDTjXTn?kԃ[JP_|@U!&8,[`Eg8U0PpZa"`]TDY Tmv Sk}"J~/r;)In9r7@՟ .\lSǔףY 8zW4Wvj~A~' h3OxG)T0AUkMYvK*5#ӕ\ (F~<ׅT|%و# D׉:yǭ|ukB۫ySUAn%ց5'K6)&;2db_%jʼni;Ṃ2=O~ 5X]@K;V!DWnkZPȦ`CB^>UF\E\usT\휯 S89$5 (Júg)2FCS+ySJ;z]Β#6O̢g]E V?D?~ dj Y%]qԥyM}HV h|7`s%RzyExK֞Jsh{鄶w~Si,c DcPdTv%`J,5$SWQi7̅q*}RHn9hB]tu&,2Һ>5Vlr=TI$HqyM (uD5הc s1:ݤ[{hi BθO6Ol=;EPA c'XA.ՖҫM2nrJB9*0 E(QHldQkmkDm<+x~9hF>9؂ЪkonwX4L?l7ણ3cvp!̞:)}ӡ2ἓ7bz&Vw8\g}nv HA㡹jZ)Xb1< : '#PU-$Ͱ "?~:^$SY- iX:e4=EJhjDpDq:iܫ5L tvs2Ԏkl_F ߢ1Ls LYjh`yyAYt?1j}/fx'9[5L{ZZ,M2d\mSǂ ٸg>I~wq| ST+-.X/IOb%mJ4k G,_{#ѿ$ K1;Ct I9/߲wETd缲w/c{O]K \?ؖ@^DbO$dweז-t0M̧=niռǀƹ縩GT%BmX)k yЍRR/f×0ID we֡ڷuBxK)eK6FF 0GC!z^ %dt '4͉cTR97\С[䡍H'| POΎ%Q~6:~نQC8Q6P|qk8lOV7z)ȯEI/%z ~v#M7 's4+6dN$>$>tFxy븀|u!gu_P-ӎ$fy-V<n(Ծ"< j֐eN&GaO64 ~us:c]܋cph5~<8cZ>i7 Hi /HӗH | s$c#I}IxI3RϑuNCmB51-Kz;rzPMߨIsEZ%}~mTH ·o%cF*pPIN}Dk<,hM~e,Qn0P١:_ z3^\XݱY2O0^y(#0]zkiG()}Z k>a}ƧcKo{<6zc>=\Sc }Ԕfvj ؛-XN+Hv$Or}Vȹ-ܰxwnei6؁1>f9;a$h# ˱Nz?;kVe\BjΑBkBjy*qzf֗T!$lR w!o͒UQ+dE]Ĩ9!HZ՜` &1KtԚ膿_%f!`kcvIZ(p}Sп+H*>hV6S K!jZ"8)W䐬xrOHI#jw3o,o*Zrao(kV,Y/{&%,SBw.=@# dR\RZP RU[CZ&QU2R-Vd])D(jPnT2-, 쉞aԈ*52hE%>b}U tOҕ4hf9BK0 ށ)&L)8b1#=ixtSc CtR?U+KnwӐ t14~C@^@ߐbqIfxgq*ִ%6D0+S,5L5€OM:]P0S}l=p_H:! UI A ʐ¯4Nr)S!ZwsF>!]%a25< ݻ2\WoQCyոD򛈜M!)n븋b5b-Lv[O t`& ?N;v(T CBT쥅.EW?=5]3瓨(c*tFMњ x<#@ڥJ1M tٚd/{A\[{l3jO_\˧2sd磝12r"\1)ƮGK"Y$3;Yfi>vz9WɏU#$)`ª)e $6JMva;!oo Sy蛀757gd{j;8cyLmatGZBebX^P ݴgjO(M4HlРcif1&ڱVHp(RwԮz=ǦPn] 2N,M.c#';0Gr +%'Qh6{lAM!9X/ z^9L*+EL%F+,h+,=MPJN*ng E댅#XbUŗkhn|[vvBinSX> vXF$wdPGIdOE vM@6Uia}i/Gs7KyƷb%ö^:lH L%tK$uuwXl'h7=X%?hl:szlSק+E]Nn i:R4m=mP&!Չ-S2XrsJ`+S@J"pZR a@[UD\S-ly@nDj22F[(&P YFxE})ZZf$JMb! pw4kM9I>m4[}~VK[ڱDi BN`F;!QîT z\Y:oBU?[򆪓4 vN>$,|C< 5TEJlD8檬~;JhSi`3ޤqXUvMj}UA%lRMgOpFC~@.h!S Y380y l[j` :pdW\^:YqPv~$QQF;#f(KEg,ئJtmEcH( 3(˾)"3{}.aoNK\Kl:!`&*_BU\Θ{)ѪRrAt t2 *J$}6;DB~RBvzpb*0jaŇ3:!(hV|(ޏU*Zbp3&Vã^YyX@ 0K@7&~ ZC1;dǽ& ƗFY>Ga^nFeNadͭa{P&1.mߢI: z*B%sp$nG|xO>2ldMMbF-{>f7B@B%'|yp&|ჸ?K@=4Atn,?~(bO뽑㮟XME *_~2Q߭L!ewnl"~eٜzj'\KM0[\)RQcj 46L QCdΉO nm*M:}]+2I՞W-QmgEc՟gA3OSHBTnB;ѡ)j4n6AQqäHmɡWr5IMi~b|mOV:q* ؔR!6;TbgDWWH&ToJ䮺ŒزT 񶌝:0w⮷^qz^IOr&5see+WI%ObC4Uʍzl^X%_B{zW%? &dJ`Z:R @UWWKYBrtX<"pCH ?bXE~EأlnJW?麿}xq.S =')clmH%Ogg(Ғ".bA7Fϝ^ ml {3 ĝ:)tZ=[%"[|׆@W a[hyZBҫFty+g/po'_-JZ&#לx7~(ƺR 3wFnjhC;|Lr'Kp-Xp}6)k"jHs}Ҏgq {| n̾$IfCtX[m5hZRvvP"RǝApY8`1.He4,F"-ʈ~ɠ++t lR*pVմdU mjG丁b.T 2B'!ИÈnzzސZg]>7RWVPS'lLe -/Y}e%%Ohɾnq)x-j>x1<2S  `0к8 aϥ$]~~$(늦6dV_)&^lNOxXF%sYݖ"?t6Ëΐ1-c`_5b1RdGx}Ӡ("M_nHʹ tp繀̉)vN :S4&:t+**|pԛIK@*Q)Ru7dIGFkBrGW6"Ŕo 5х 0QE4sӆ* /ˢ;m5i/$of aBEY/ +襘u hk D5GkhMj~ɢ]ͧT!*3ll;|S×8pR+rx~^ b!.#<H os !IR +6NK!<%'tm992kŃ6/J UZ 98;y()I>3rknlݧٷ)0rmN"ޮ?Ɛ >EMy} X/=p8^f?hT'_.k8^Ư Q1ս8NE)žy6Ts+8MWXV*Ylf}:fǽu"$CѲ+x(חSmfy7'O4eF~:?huRloyo;:wK_օOAvgPf߿}T-z߷׾=/?D&|@8 o~lʖ; F^~"4@eaO3yaNg@Dv356pL4Ԣ6{U<S*\ YM=7 /$Đ_ \d?_YSv*-buUu+XCY Zo '4.bnoIK}OE<9 ".,I&Φa PC,Ng`Dp7etM|'"5Xn!o/gg~t67Q*R9bԁ)&2E6~I^WA{-E<Ii*!n>Sj?: 3b0Pz$E֜àhA@ 1a|pN-Iu}S}]2]_%5|Syگt-;Dvcቒ`/4yiY!zأ ArjS=I\Uvܿ&IZ;tSD5b 1LF Sv[#Q(Nf+l6pEN?b%*pQ1$9Q^UK{ڟK继,Kv8nS<82R$rJ t9nΆL^< 0 Opyn1kj~! .)8R*'^Mg̠$K;&~MTjCvQеœE2xpZ G C1w̧o#(ig0NKu*+zmRQ:-I[9G5Xuπ8OElUJgTM2m wĨh*B,Id}G[4T,Krl&R;oi2-{ѐ8ibl׬yq=KM}nXعzU\/ (]"K phIǙGD3j̴hgb>f?^OERKKWq'L|=y(:FI ug1bm7^s/Z$U27MICI [*Tc~%9~? S&y`HtKo}0i;ӧTQ@ Zas;v м7[ո7;ʼn:xN(%:!c#̩ex7@S 2%pP~ട"fwy|r2ёV37:Ѷ\tm}b[˫o@o~1(7xhv\DGt3}(@;m.S_89K:E1[aVs?z1RF]cG_X=SQ^L) ΑoZW5/D*k~>m*U7'tI9gf< 8zf/4' " *Qm;_ f\h5m˷wl.el[ 0:F'0hbqcBP8ďǏ4`]tRy-2)( j!C3dw3C~}O8_ 3]9DSbbIlH2vSuX݀b]k=YM,fhNԷd#'˞^b+Wa@J#e05.jTN'jkNҒ; ^]p5u _u,N~Tcrr͞vAI]|tEO Y征pFmxp cXxTld>݀Rk:4gYD潬.^2T FHzkH#*u)߀ʄQڐr@i;T"s7ӹ+lC2J4UCiTKapKoP FO.T&gf)~>Qa6&`&Jѡ1< iO1ɒB˔   d!s?dׄn]nlNkofcO/ɮ mmT> XU6N} nBT&qAOURd-:ש@v{CMk*2hލe+Ĵ7$@ԒȾ}G DMP(/h 39}n{Q?_@ s 'oҋ-t7uЎq!/r - ='>~}j@$5`{a.rfDzm!m R &\3f*(<7`|EL|ëMrޝcH&4ޘ Sm`};c~mSz*wkVsR2MxUb|-d>}>Tvя4a,h_vZZ*U n- ǨT-VWpvuM |+W4_Ζ{jv^e0CQ<`?czQfٔY)9H62nJ |<=A.Nn|]Z,!~H26iw|fw.3]/Ju;??-A^q+~} 7Jo Ri+F>% 2$|RӡIl:{-B[Q3վfxnF]m*޳YZ;! R?oiā9I'r8I2D"xιe vXGK"RE7%stM2zG~\mڧM21BK2j.MTgye* ƫ6Ǒ)|/D}<׼IsTn,0k[j,֕خ@аP1Tz#7鍆֪q$ 3^HSMѸn$qJM"`fZI 񃣰Nxΰ)6᫻$֒ob2dvDqq|Ep]|tX+vmRa(#V7uwfq)P(l5,¶6B9>7 {'5o#0tߟCZGh_yjII9U KK߲ܳ_/9p9航Yw:҃6xNβ4K殧X9Xq?iӀ<Vߓ` o^)2^N|)59|=X|u! l =Bě#PxYkx Ƹ9GR̩ĺrZϜN`QR aOGG4 $ psfP|q^qq}fNYe遲jEh5 uN Mzr82c.<@T@t8p(4S{N`桜UP\Gv H*d]}:(7ҦU>Q\3' RٶL5Oo|y{sIDS7.jdah,JgC:*]N%VoX޽pO9oPcXsNB|s >rB؀^ހ %/ͫtD>=ϩ,N8 "6=ˬ~WN>n_ʼnD8c>ڢz lRF:_HS,c&t94ȒZYEg,&-.9E9fȵ7Xg0<.9M2͐{n G~DQ%pS`-a?dˠ yׇXv7&&J!B/N"{9/Uz6Qn>wxjXJu L)5E׺+m /WE9%⋇2#?&w3dD&{ܬ`J(Y=>P=gUdRUC=\ˉu51^ZꔷJdUD tZ8ǡ32t-~G;Ƌ!" SHuyH/]& Mbf ;1Y/P}H->T1Qf'5[1U&SU 4[9-7z$ru2`q1i `oRZ4':EQgG0]\4;\yoLD7=!$q"B&N6݂rl!ǰ0)OX0bXQ,H]ϫtOȚG&^DW`e B7f9qq*QK궭x4|,4hEJbK(qƲ%8mնipڴӫlVagEY}Lӆ* (,hĉT3@j ,m> %Dg6YmSl?Iz$?P̃䢩܍ @v{}ċrbh <mVm Y-17nvI3&fCk 0/!K_\ܭM V]0R0 x |JS,$fY7q_RJP`[L!{wD*AIr\?`܉Y'yXy:KuEymIwR) &gݴ%d ?![ao%e3'E.$Xtyw'8J6ԡP-N. !ϊ4H LY&pҬ(c<|cTT 6a@mVr٤ڥMay./QЯM@tM%"Bh(J&S^aE6_5 i0u"zGaj~S7w`eZ>PW G%(3Yf$}^Ǚ9W{56M.F2ыN`%cQ܏ x0Va{i!&ق AR)Qc*0hfZi!Nq}ԁ1!7bނ (8C3vQZ*G F`K){s4l d%|-&JL" v@$`>ݨ P_0fGFl##twXN4ˣ)a 'kқW^k~ d~cM鎝 E\oJU Do®K* JKgC}]qAi<57k}:A M,A}bҐn$I"=n;8*4F89"mz樂Sf .13^}a\jB)#s)Q[7AW/;5(U(ˊP ~k*/E锗|!(eT*? p?_jQ(8BA-bom kjX )c:OI 0p|&%* W}8%l6I5$ħĭW0mUC5@#:q s:7_Wj#'^:CO%zH[~VgSp=k[ڷzϷBӠcU)t i¤o; VWh\z']ǿNY?ۏ^_I0o;u|iNߠ(}O﷧hcHmki 1>|$u9G⁴fKc"L큖 ⼇* ƨLNxO6FҺn!8ycQps(z1+YXGget @f~?KE{:<'v`jAoP^0u/jç/3P<'q[)ˆWsݞсwK!o= 4.ԖPBG ?1 ECb (~v>ֹGq=K..X>~2oK4dM\ PYFwg6,BK}d.$$.SCȖDz?z Rq? ,iy s돠q*7"/`9EЬs_iu K튋rkZl53d*XXGaQ굓p",I)f%y;,8{ZMh8Lh. "hpk+G>'y eМ z[;}/f?"mݓ2DO#Fg>ot>v ЈGϦ%`:Ĝ/}#*CÉ4Mc"Rmljtlޫϱn×סƂЖ3vI+tUo+k_kL6E/vm@Z+.ʷ4dvQmC`c# 5f.(4.^KNdž+94V߰2DECAf얌OhKʵD]>Q~T$FI`dŚ Y86HbKpf*GM1,%\24'Q{Ug@B/~1բ|>CoРr]#ϛ_WpHfMVͦG%чjb36Bhp~hFF0:jCKw۲A^AJn~@ . ţPRO\vJ»95D_>B0k4ԚH[ό-ggWk=IᅵIrE<.Xyz2Ȫf-iW#c?1y_N۲Qn)Rs/TC4[jv!J}ܢ "ѽ/dzাՉռL,Vuff-_iezj -CdMIݲ+ac`_]l,~*KZ1<,nDiW#gQ1=#$ҹJr{DzrXKEjtne-݊Mx^R7i?l'L{sS5qIt oA"`lKa]؆aتyn7r;UXbط*)L]quՆ#4|`2y]wiŇ4Hm +bG8`uݦqי{MyZL*+D0+!++ޮȔU1VʍދRkw(T-Nty`02Т*YԯzRHL\ʨ:~[T:DXtYC%}  Ojҽ ;F:iyDM'+\g>lDEI 3D\3{:-$]I[㩅j)` SAK#E,%;H!*! 0=krpBjuwMw:d 'WΜȒGtt2i23= ՏibV%L]j(9pxFd.w8cvT۰o|)r{{>W9cORd^kgb|R¨[X%S 飉%xS:j>F׬f.]ew6 ]Dp OكNSЉ0S;>No ^`汢wiC 滂%$ Q`,yϗaR;Z-h[3ɻdW5J3v) {n jMl!;Ți$+Pl-ZM ՅTA=OnAZ|=3F:[ )g mW4j Q@,]a晠}R䳺05+m՝t:E3bz޼^)(MyBV?Mjٷ[piqlmqÙO ;ii4mwoVjc|+j 8k5H{-־تwW7@k֟@뎴iH+!К[ BZ2,{jwmن}cJv FcPY1x$ <=nm-Z lUϭx"*iұ`v5aKHb$p')f_~oνsGz 6#5P5I\gdϬˎk U]4"簦8̨ax#\zoWŌ$NTW1O3jT UG5M3e'&3o%裙%T/'&*xV)q|3bf %S{2eAqDX>% eκ*#rlfL\&BX28k2?l&g&߿FH!gvR]ؐKT6MTU+[UOgRp^2\QgЋS$&2inר<3pG#%,?ͺQs5GVׁ)QX(DTNpPz/ZOV7(_^ec : ;*3 u4DE9*,LW{ǽ=n_>KMX8uR5H?dP<-o %i]?. RMܗNaܝJ/õ<mgRlO39Qɢ){u"M]ѝ n)M2v>q26.K6Bf:Qj;\ }= TVZʕBNfmqxTɎRmV$ēyD?:Ć'PZqqcQ%^?BTV%:/(r 5 Y!i֖$QD7bJAA/kkTmL?(7սuZwL8A";>#|%l=(84A` dKö`B󐉖HĨ \SRB}"[e{};鼪m=~ ?"x<4svF_ϩR.x(Qu4c_N.* %(.rZ d,'f":1E/-h=nCoK{-K_ފ6 Ӱa\2yy<*@&ewMb4!Q˦ռ<2n+s><](M[v0&\۶U;rsA= ߗ:4=u={vCv=Qz,Sw{23Sn9}jeD`הqDF%h(Uiy^Qe3/]# 0&fs!94>@+ic@u@ GLf_g;UAo"c }фNV{PGX nP;ȯ&цҪ6FJ`<J J9<g7fL7\_M4U }.j9u#9аi-'RV)&|Kx7 V@km]a6F>3Rڢ@BU{8txh7VTm!fö wpq2DB׌)yjlk#>izcIځёqX Cb[XEar3`k)9*ߚ6R[\qE/\ b( cyXc8qڜĜɤ[a;%N+i8&Z>8L-9[o1$kODp=ChozE5qM6;aASD-}n,cfc,yo. &[ӿm8NՋqhˆO&,JUO Vm]%1u`s,S+n [f9#AL.XQ">ַ%XOlXw5@g`! {S`)suf&1B*28ri@m<;-G8؏AA h] 6ձQVi"lnҎj.h~7ů]W8h9Lt&jr!/#̃%jq|:/םwZ>Y9,;+`+/ SӬ/gzޢm9hMjMSBRma𘕇N0+J(?nxr\P6aƛ%uJp]xqfhqby08,wAa`~zTsN;)# :1,4i 9V^z/ &/eȣ 2o^Ad˥_~cJ_s j3l%~+;. iT&q@veFI՚N N٭m[N>KaFWmS e;OX>8X܂|8cr$di2h;()Ɣ<_xX8elItghC˩;57O䜢y}qY=GT||_#`߭vnveΓjɯm…o[9i]zw&o{ I-.1^'ɮ,_&> ]]0'$4%BT|f/kȗ+=~g<<\z ۲UuٳpL{R;Q#P4_>vl~Bveo$ѾF.{շ]#Y_&>nrCk6FpkJD|]jF2[YW,}wehOtզޔ9ߌ7J?̯2 cj?wu]>G->@#~[}ui[jǖDXD3Jrc/U8h0~&*rmTHܢ<B)FhV S*oh00MENF5vH/ק)^r-Fm=Ntzeop|J$7kKw_ANjWŵXSp:ܯ8HIЃ w}MqR.x/;聶qP lyJv7 ڬL2+[ ,΅J!N5GgT*o\d Y<wC^N6CCLбs_e&Jk-$-6dj5B' Ω_dhKXD0~CE 1V_8DgQ 0qXFq-UFC&WDbk~KbnP`צ~g` F oۆP\HiaNhasV5-2(Gy9f m+ǭ" Ѱ>̀Xn8WUlu/T6Y-('\8JoWYCygk AJ3>jVA2,߃M nH1ew$ ɘٱC߾fgLĸkw)Ue wسZ=ONo;CTZe_?sA`$+i0lKfNzT^Z+g(üNHT_39Ԓ< bQ-}WeY /AAXԢwRRgo.!J85b1ߵ+O;mh1@+,\_\,~YsrtoFvD)xO|1}qqvDBeځd Erplݞtp&JCmdfpfT"ϱhXAێ";Ƣi^L)+3|&ō=!V=D_2kO,Uj綬! b&ȃP(rqvAۄ ۉ8MH J74ef Bd pnXI$H5ԑVLj49QOM$LKB4LFQ wfB U VnMlRlzokeijOS{ZCHSk{μ `7JY$ޮA/7IYy~IY?@I]3)ee#.yxHȐofXqveKou^8yz]2w-scE,ެyiXR8Ļ:}n(u+/|y|9HFvWBę D_Cߨ2NupfG)&-:dTekuYH95wXKKl=x`4jLBБ 6wK2ֲ+&>yLE" z$#([p(VT::kmu(ؾҴBhovIvr`TujjM9$XEg?p1.$ھ&LEjw8 /Gz=cP PHq_׍ w>-*YYHI J+K230뎂 Ůqww<Ъh-Zm|j|jh|EK\cR72YjpFZu[',yY< h ]cb3H>T(:3Ęsk,~"&F;֩*FI=m+*az3C׬)Y\ "xYq}zٖ44g)kUgQ'hgD 59VA@A9 &P;0g-ֻ ^c5bLN#C8jB@rT֪%Nǥj޶usH|fWrig$rm,x1qыD.-F3 ^k0%C!bUWKQvwEQ%o,GJ3&$DkSBH.6Ti?4q!jh8׫L#E 'pbl]٫>n{?̐A^vϺqM M\j>}ِu/1d}Myp9ErTL=y<9֧~m0E\G I&UD7{5H!Ij|Mo^ I(nT|qdg!zԚ)M] uINČ(IU.^~F]Pҥ *ރW60 W`oY1wgPq>"<-ӡׯS ^Ӵ݃LG6 VT6}9q_AdROi߃+Dewk3;Ntl)CBb;42Z}zy߿hN|vjrG]w^?*ӫ[Y]uVYުiXu)m+f3ٛk_Yg (y{؇FQ/d4#DWݙm\~.oUj|St%{M+^6erZI/,Uv%!=d$+X4 vmY_p닾7̫^jM_Lvol|k Z 9@EL=MLOe(p˜=_/F%|b֓-/OE= ZiDrNu̚qt}Qe:<&D{A7еsGd?0!sA?qݎ3!,JB:`< KӋ<ԑ${;f)Mԇӌ5V:صSҮXu WؿEus-;y9?m јvG ?q ~2u d|S}o;~Lɴѯ~>~B>J/|,}$583 錑}bAdE ŖTnDD{z~m(hE@?YhUf &:FiȂ$Ss sa+IIʷBsaՏ(ʿ9"B_4?˳/%5c_o+red?G.)MyoS =]S-O;{k;='~9~bbo%L@{lȿA=\|-//C[0"'GdCŒܼ;~ZznR?x&xI҂qupJ,7bޱ%Փ<ƈxc2(#'_`38Rp8E&~zQȗδ& ~{i~~5Or/D_3V5IMnE&0~BN%. ~zw{F{}MWx(~<KP'٫])$>z淒ZH#l[CZ)}#H}X7W/q";igHi_:م>tWW5U>>j_ڧwxOn܍}gUIӢB>|hڗLqmxiDY˅^xkiMF!z |x<(>8(D_@4yk g&+^sG@_z4ȗho@YNGE@]r?_9d2PwP@Ql)UDJpl)"ЂKn=! O8ҽ6n|ab@C D^b p{SŎ&K "duYy{G 8֠\ES#9QC@,R=Æs@!` ,‼"9J X4Fڍnm鿚D" 'k`0Q aD`['q> K}` hs轑@[bN" ASſz7O J|!jRk_ݨQGS4ޛcpcӲpm/OqZ7߻O/-ئȶTAO '2oy:\'BƜ ؞.-o֖`!Ng[m1=xe ^yA^W {'WgQPT?-q z]@%2OD&C>FdY"M1}Y3aĞ+E-13. 2å >+>T`!FAHR)_⇁|(ungC̑}5{񫿈?!U%#EΎ(Ζ|>c\R,PoXeSt< }K|<WEb^`-FG2>5i+; ~]?&ǒ>Ż@ψ5`gsdʪ6Z2%Q"۪O/l{?ݤQm/D?ݝ_7nnyfV[?C?LH]/!HZ%y֓so_PП^nֱ4n~;v[[X!|1)U_ecb(|MAaQ󷛡pb?vfeOl^igp6c͞ |X^f߻De.hdqt</ ז#~?~_JRҥd[G;D :2?=zk6$ ֎?6:p%1,!s$@I 3tڵ[h bMM(`64aSL?*ޥ6ٔ9ͳ6PG`|pv4i4AK^8kP:%fli":u?}3"Ί2A33r 7W!T ;_&_OeC+,Db "^S]J55Q )8_F\+3ǣGgSV7ǖscyW7C/rA.kІw\mi/ƻS f0;k)4nu @V#wnI<:OVxDW9ʣvE=(ԙR-11Mz DlI4@JUWPƋH`: 5tg9) " `nOAB^n0|g9V Y7'6ؘzvT2A_\N`Ai*3ݐr #EC> "KA(F`ɹ,?6TȪU *]j Df  FE\.rU U|̾]h {<}珣uM2'~:@&D+oM>nߝo>Д-@>o~k1=ק_V9,#!udjySEB]CQ3.͠h%pQEX1uЌnCo3 l?[e߯q]\tm*2gS佟 Dn%;2sNW^-y {_;@5h0u<2<-4d+R4ZoxZ'EdsR}*Q 8) LUtB3\K~qMn*QB)".0͠"olEN&a}Yy'2XކV^˙h++ s0KVdcEF!vg`?42а)>nYU'dO F@K^"(2K/K ء3[I_)c7Ǭ0?wYTp~x[֘bg^b* U:WzXq݅zǩG6Ɛ)qKc.ԃ{} #wvvK̔(`,4+\U b.#]WY2#0Oag_lSLcP>_ ?H؟s@ໜ(O`ѱ8%e-YV@56~ җx)\UmouDCd]q@"ƭx#~ m`1튿>v&71!nԈS#ז9 T TXt 0=HKr A Kdi'& pay LJ6)ȟbycqvS\{KƦ- WKU#|XOjʆuwnl?Vj7iey8߲=Eo˟P;Ja F_PvlUR 炿v;,AOenٿ0ˀnҖ[L~ O'-%JD& V&>f˴o|;+k=XțrC}, ~(;dϣkVH.vI@?~B|Tw U2>2eĭzXMFyk` 'dwܽ_UiEX?{lhk[Q~ƾ7֏w;]?lv!%.ܬطG}ŞW݇:w~ٷx<6'(x;tޜc9>E }{;ކMjwYGGym=o=o^sh6{o=- s|x ;9jCa<-WǞ7=pC\fW-*m7]Bx&^~ҼcTGǻYYZYHkT; K.3+k%ELQ Dy@=+1EԻz7iyv?!,+0EvnxDIt | >s]Uz^X/rɩ$JOb@#\oYi#D%(j4A~EOis!;VSaA6) 3ڸIxjA0MvMf# sp\[?wbu7+N9SC{n|_&-0P#mȎb-nEB,k1j:-<քw&2*MБ&K05 1LT\߶kGZnM i:3n3ҫh.N(v83omx45=zȍ;ɤ0xvT<Y}xqGY+Pг D=CWWkUZV}M2GT1cCp'֞\]k$S 6-rW ­ūrƾ`)ZSN[TfF쌀;"c Q w@@= bDb(Dl*&7{(0 ^]3hL౜v]qH- PBF,bSjІnU1ElC|YN$̬xzЉ=B`|Qx-IᚫՂ17A 6= ~m"Y|Q%yJ(nUBO z25CjS,=j{7hHu]B@M)\3dfڔe*FgKK+eP(:l9CPBPP@47 T=3@\rY''خ.ZvDi:` $R}yS?ZJ/B//O^~΄BocF$^\+t-!6?4zvlCȅUU'YH5se ֳ1o Q1x:@pZ0@R $0$dHQ/COgw^|}yp0>/#\Un~?wڭU3"^U.?.mnCW[D6APTdZohrnpIATYU9Ђ6. {ܩRV@(Lp@m%\L0rl:=!b/a-mi<3X C|W5%|kJ2ʣ'5jdPsɇr;\ܵ rur[QP=0¯R! =i*oxWIj6=˥I#|^P3jގ"WiZI^y4)~5gZy_mTrkFCLdWCJ!]FI}JU[SkK+#FJk6$,+#āv$ Wf[@tva*,t QbqĴԿ>G%ֶ/;Ԯ.L66in*l@RZoq[xxiS'^w ,Tm*Tk)32C[B~Q y)!>z% )ӌ3ܸ mY|ͧ%󭬥߷?WN}khoהh #JJݐ׽sz˴)ɧVTj}bŤL6gdt"R0P] )v-F%R-{-SEx\?= .GnΑF2g-[cĨhdKMnG@IOz֌$bPrmsԥD* 1nqrCc*zge"R٪K9 XrTέOS p-ZqmGAU~;IA _V2 vz=YE0mCEs+:fKY*K*ZeԮUJ~mWGKC}DKtb4$]ZgN_K5(GbI]L`)z~`DPUM zjՒ#qsḼ t{1"Uխ=o+^~^>&(Κr (Ytm,4z$i[<ߡiVl7)X+(H'b&ua*o{뽨d*hG1u='*yIuʹц٠]Z͚r]ۤxzQi\Kv=~7vߜ|礠5DWY~#%&&u.=7z)7CcCҶm-U)zďv})wQHlVgyy!x }-C XOm\3˶qa ^{{HCK*+S>c "Ӈ z*p)Z6ϟ><$8l]~E͝Dy牳??Y8?~oMdIF`YtpwRD20HlVy C%ŐoW8)*Y=%!]R?&瞋@?`cpB5Sth-ut`l\pyCa&}ZN~n+ײd׻~ےEu%$ÐvNt`\f}v$L 3'[И?E`8ϲ0!:7L8TKǪB G su7t'M`u_RxWron%tǪ`bToćFyWzPM4;T7x(ݞ SKB^1FFxU;i'%d"MQW" hJ`;=AUḐ( Tz~_;gfгˏ:g V>@!i ur?X-+'V8aLS. %x7VþUsiUrԮesOW8)vvn-6T?uW7Q@KfecǴ"9HԲ% ^eKȝ>yG#A#ANjhJ2YWcufaM$ 5Q7ܕp[OW;oY K&xl؋.YKYt'! 쓝JB n1\]dApF;"c*6qG2uq^qRd4e{tl^qҞ7_PGX}@S`Lf&ڴW0J:lx%'Pn D3 (̏5uoq6)𫌷nKEwB-4񢽫"Lqkb(YpV캋zBHS[%c1a1$ So`(GJۖ ڜ~়N);/lK;ئNM!_cäzfqUua%5\_MY'Ϭp&/b$4.  BI?4!0zkچn\AاPԊxpxIO|cv%|a(Vc{Zޣ3\/cb=~La"W;`Ou:E' O]=1h|ylXX94诫8!4mM̄MPF:=tP]c {!; 0<6Roa:b'ӭ EhBK XΡqv:9 JDV .ɝ9fB̊7λx'\ShMG`=WLMbﲃ8W`2#6_zXൻu _{ |:6YIs#x裡hRJ)l70c];#"π/EfF::5܁ ziҢ!T'?UԸ k[M8u>gUk'`Մ~Vh&l}K>H͵H^IOC5(v u_+,V`IַB2WorjxDUDJT &]("\`wҞfRx\<[CG:fr94R;!`;F [RPsF)0dMg&=Έ˹?֕ |iDƧy7q:nS/Ū1AHm.E:j[\GO8)%mf)Adͦ٦Pm ]<.sFT8A"X}rgeP/AWjڽ5DG'? aN7p!+x\pg*.])ziK?EZcǵuc< 1`5ml 4灼yMMӛ$N&GuDq&D݀I%߲OK#H-=q@OCq0{b|c̤ؕ·^.yQT:A~|ciJEA}oʅmrb'JCh*2{Ӆ2nq.]NRDJָ3SQ!V<*&[O^N6:k(Iuo]B}UZ78JkV`9~r !0VCz`% :ŀ X%}QlӞpI̐N!=>)D*&6%xז6+ Y!\I4q1$Q>О1j~ 9Nhԡ:S_PȻK}9ۻTw,ȚWQ#e_󎾻[k=}[,yѡGuB/T lQ7ُ Stjg>ɼ,j-X tlvA"?*"y=rcN {&76:&>i€܃ :|DFlʦTѻ,cnyM6ImDvt*1am.. (#TH(!`NWQۃVo~^3˗fOar/Ws0|bDtW@.Ш Ah%72+S#T>* j̕YX~1QYpH* tx dט/hig!A6r6̽ +`{c0 [)y4߈$ $Dt;cQGS{{h5RHJꂬ m#ݧ-f%`#3PNLx96n~v쐦upKO4$ۓgDكX[ƿx蝯_NqܜI/v>|懝ӢN\2݀gp4~eH߀( 6EӇap8愧.12Ν92 7 h<ƷSV=0Q=$Xs`oN~ۿ^~/Axď=8u?L-sjV//ϟ,n&" -/;ӈ% NFofmzv]ס'fG˗+|?i̲?%?T y(CYǚLM\8H.y(\L*jkVm#tuEQh|*1fkj>4`בho%(grɩ2 1_(=ZNѨg^56Pk0z$0WͼVWh=Z:2]ЪA a5Pb94l=f3Dlᶅum=^@#joOS+{Dpo lji?l(sFXqUPbUtJlA›'C%xм.i.#/e;6o`QfWçXqN5VXdNM[O;쫅rk`YZcjτ4u;g-gc{&0MVk<ώ)‘tb/ (d.pm3~c>{t;w **ol#ȘT_zD;@-Uew NSALp]Dxߑ:XخDRm28͹hTZ\aNEP&,ϧ*!yItP |JDsXm"Y'c _ g|A}KA='i=ZI|>IeiA:}KKAk4h?ό'}K}̬vRI9]KN9ӕdfi4A}31NH~!g9]&=B2R[CT2s$,8"KYA_֫dǎ+\ 9x9h K^KH!@dd.]|.yr";qV2a⢎ZW2Ev= c(yè*ɼ4fbt V`Yf,Zz6Ѣo43aVcm?8JS 8nTSPn1Y nU:|ySb{5qE>e nw>iV#O7r=&}X͗\Ϛ4 ^;|7auA^r šBsn($tu|p a i">o4̬̔֠͟{3'8ZDbVu[Yߞy[3;.ʏ9g<P.WO`ug]֔OnhMBM:FKqֵoT:]Uxy2 {=E yrY`zY}fvrD*^\-gSj*8f'|"ӌ1D/Yf}^ 0MjtH= (x``DPX>#`++xc RH4m1ՊCɮM>L QC [3[kq߉zv&ޘňA O #nQgS5X+kCLWS/$=83Fix3(=T"GTTe[4xiq-盢-jM̐T$A4ELMڔ]j7pRbH5I1"'Y.%/=q@~T*:0u21u:pz&&}k6DnPL2%k&;,KN hծ8S/s3R/#a\b0'˂` ,fU)P*(&8?4)8/><4jaL=l<]:vG$AwXϦ0m\jCm&L8I.NmPW0mh[ jC-|O5_!c{,C\G\6YOCj.,)+=?߬+ӆ{K ۓp2,< XXem]u8>bR|Pab3n)|R2(}=JL /Wp 04v$ld^#[*ֶL:ɕr/HHU)qfL U5WE꣒HxFj[, .\\&*jIb7(T_I%ldxU薙H^*ɒ%Q,٩s]V<%%U@:6R] 9Uc 9ҿ~haX] ؜.@YttM y7c_}!*],&E_ B`ٗsȼ|q{K 贬xȕÞbtc=ebad^x3 @mQ50XEh^θ~}xKiA3#j4290]'Rz@g@]e vqTT8s" ^7Cb@Vt @#v dtv`Jj1=pNRՋq]c裥_|z_Ru9˾3j;5NK` I!2]YɯuͫJ1ZWP 404Q" )1`dN kpQ})8j(LBƤ|~\)*0W/k ̙ި6~]TŗYXƹ=ŧ]peP(qc ɻECVxB{ ߶+{\Õm81j,u 4}ؖ,H~mz"{*'8ۇWàfjvo{':mzO~'!*X.'ϯ{ڙ Ɣ 5U(n~{/?kn_˻9DETC2ust_nՑ9ۛm $$r"+DS&~!B}4gQe߻j&OkNi K+)ў|%IMY*҆uRn1Q'5W vMEg eHVT&:m-@R"CRCݾ)V ;dvD #ۖRy6cmfkj!dE+mS($2c{P3:`bEuǾuձk._p#mcS"ZX& g3f QV4IvU읇֊!͑ᾪMF*AOQLxupܛ'i7RwvMbhIbaɨHbX Ha^9~_+88r5[|L\jˍp Qӈ쵝z;ű6YxTg x0Z|eʽYSD5~V/]"jw5PG#l6kR4SbxBF\"hiqoY (CFYUH _|u\oA 鳅#A"izU yg4n3"$ gr\mOr4ZKR ޏpYG<=l=NCD^Ab0w{B젰FA * Ѿ^ Mo.4|"%'y0{eiUґR6*=%$}b*W !D`(*]*Xnq^8y(r{>S)ԁqJSD, 6: D٩/ YB sn0+de!k/nb G *oo,f4O߽/}:jo<r|8odveXd&4|a;㯫sz6W FGp4.F7z- )kZ46l6x^LsChb!p,1h.ޠyS࿬gˆƆwkx9V8D˄ƨ{jxjػGr㻊Ḧ ?7% QMR:SCL@y끈T 8KCTm.|O<ϣzXn yAoPMe_>sG-<PEoݳo>)Nn 4{'7R[uugo/n ٩@JPvԊtlr>CO(khO#R- n44b$Bo\ -*˻*^}t1/D]To^U;me T+ Uj+ցdv)Ӌ~\&,k7 BH;uSgs: W ->h*w$[HTe]hm tlE /K(|(ǣpӞF @WFRtp^F0L9|@0fF)K}\ﯸTyji&wur}'t4c9WoR{,1HDY$Չ9|#<(OShhFػ\|H3WN8ȅXaU :߶2(| N; k2GkH~;I>Εﱱwn0NRbgKHez™3–^O{vqO,DW\<`5|}~jNNkWT_hbYѯxwҏ͛άíZl2cSo9Whvv> {v;F ;.{ M' f`@I4h i*1<dz>Hk|1>_ /x/)9_WߓWwobs|g! [qF2l3jZ2#qgֹEd9 :M4b/w+"8b4#|#5{Qf*bs@ ~*Jĩpi-=,FV{,XlXw?Fm(kTUKv-#?4nϥbP,m; XSV>}BZ#(tR׷ɳZrsBv3`J%\aO ߾4|T9saK'-؜kp=}n.C$[$3'B8vD=zҘ:`o>ߟi\iExRt˜?ExF3W2LQ@e:0U eIַeFksޖh|觤b&vspscxL|5}s :rZhoLykHi-)Vm{ LcZ[G:w=߽qiḺā&؎nkfkW8kZXrT)3ٛ9˶8^y}SP]r nLW"R/04soggOfG*8&첬Gcֈo3> k,&9=Ԇz$sd0^=㖄@p~?1SV ڎN0[V5&8*ZsUh[E.B*^To":u[{>͈XSlJ%H(**n<1,Uq $֞(22#2 WtƧ g8*%FmA&jBݶDv/0Nҏv!4.[uK85GyFQlͻ&m3쫪>4ٺ(\`kP)d;P?SBGyUƑU6}adX?pW%|^i;PD9L#v&%D7.N9lC60ͭ%+iYEu50>UL# YFܣ~{\V6Ufڱnc_S,:#qq!q,?@0o΄~O"ITTB[2Ky}OW1QkaU PDZOs8}<9EU=-c k{,^jSMk{eZmE45Qs]J`۩8OFZ=ZxhSNr3tnצՔ|'HW%$X+xOi*aF%np,W /'dԗa]\|pMn7skF`MWL1֝neĥ5 B <8;N<^fflDN|R5YV z: 4EFxoMj##.N5ym Jjǃ r0j?x}&ҝ(|X=A<.}J -AFȢ,[P5HLkD'Y ݕ`=5Sg;yHgFz?i0֜nC2/!&MEY ,Y_%>vuW>b*>*Oc*.mzw{d,UU1)&E{dSeFk5ϾE껈J2)֓{.0ӰmQ0u,Yԕe*UȚGLmd1C%QhsoK4)II7yE^}< |m8J&dh/"dtW37نDObօ7G1o5ufˮ Ƚ7^/ Yͱ,a_ i 37D%Yxg\̣=vq*e۱ɫΫc2~w^d)I` aPAq9TXI8+RLU&rŪǙ vO9|jԔ*"UWuAWI}S-}KK)˩~U?k ǮY5fӫU0avڰM#ӤJ,Tf=9<@(/gWƽk[hUw Eu$<_"+YdyVq $~@z9BY,Jd<f8ļFa@ufL`2ar9nϯT0dCp5+x0 WBeVb*@ pU҂|KσݳRi=dx`ץ`<;,{q',SLyv% ]rN(!w4t#*qP !M܏dUs+V]ٛDI f_9"8^E-5XMvEhmֈ,KWABZA T6Ϗ&H|< ݉J%P"c>r}1g@.*y!_"w:狟Iu؈"fFq|' uZM N_ʫ%GuzրOoWSI8ozkO$exM[ u^[m`6hk̷X-/ֺ"'牳a[?&PV5<[:tMR*h Dδ+tljP3zfg3'jM([rZ&;@3Tr^]GH=+V0dzE~Sfw;E -!mEIXMKvF_b)}뤅?.ʾ٣zJNכ@ *4t^P)05lwĦcS#WI@9xdMd5XfzQ_ˊSF4N)o!j8/'(ވN0@8ܼX GztgCF\l5Ĭ:7 gT ^e2T̂B ]O~׍`F`:0 O NFoKuxm=_{GJGW6| 6D{louZTa \HE S&1u $kT@lE8C!M$[)s ]~d@%hXv@@ M_4OK4?d`if"L F_\] #1KuX)DY4 O:%+,U/bZ-,N.>Y^,.[U8f7Yll49B:/z#hhp0l~{XJтSx4k3Z2njQ?v :Mm1mbym~S>zf(xJ5FwnV.Wߏfc9`4l-dWtLØuޱPP>X}5w3kФ݋dbC1PoݤNX@PB#P?ݯ{9Vr(q*_}h Y :KҠ.HZGﷃB74fܣ'J?E<}x]r 3!V-Lˏ^ ^xM?pC|C)zi҉K^,=/Ckh-6@?`V:b3qC(b-)p %ujN},|ԥ= :,Pvdx!wErf=<7kX:yU;FA."X 슊>ܐcD==蹦b٫3:7 hjFaB뾟/'}G| 7Cfǧ60.eXM o^z>'{x]fV 1_Fcj͇2ϘiAB Xby ()#Yz?&^Nr0eMx;xӧ(#iLtDvW BIv0<cc $nA[bo Ӫ A8e N F!/sA×{hc/=('>AkՁO^$HoͪOʫ$9 }4\;tAi}k *E2Iwd֩,K6Cpit)v"`O چ-;1Y_5 M+񋺉\t4"Q{R.RvkteMcqq.OݮW;՘ C**X~VBlm'ҙkcUGE6vB]?f!ɖ(16c 6*H3m1Q"6H=DN>ǟo;m]U%-Q\9cEI+~BWNY "٘ncFQZwVYDFHP5l_SjOfʳf"~0:Tems rUxRoR)aMj_,:ZT{(۪n{lt[NnpB 9wqO{-9zO]+J;}N3LS_ f` u ƎxFBԣ*r;LQd:8reW_VꠡBJ'CnQG:)[0n> 骆8D`m856!M"S36Bv>zS@  cZ\{ṏպUxXt68^20uS EsOyoüJ^4bx6ku<qe/fXTq $u]P:EB9#*uKR TSXYGu~"ḻi=+@'F#*a~~."@g9 rG\R0l0(%x4q2 [5)Hi4u,x3(ZKW1fMrST]33a[9$= z]KèqЯzkm9M`^)Q!S~u#[@3[{tw5QI>sLKڜ(Zdej1IfP؟Dew?ǜln1!bt>?fp$5t'~SzՖRRBs'y1H7/x1{x^#ڻ#Ԙ]"|(O[8֋=n_u1I3pَӊÃͫGNzZ-x1 #-U.PFYfp=tS)T+ffo92v):"޺̈F?kISJaI$<ؑr2DnZsJ:{V4M~6(g^5e&BFT'59rt{G:~sR/bnB#(6|:L^RhRm o;{Y 'm,}}]'dIQ [FApHr@uܻ Qh:x"ZHq$h cG{N!ШqG¹͙w9mGjo v @WpVs6n%=#o;Hq'kXوa˱ r@3֪xSO0o;TR ȱɻ~gwЛqTkIYj[*% 9{«VTRv?^1vac5:!@2Crb/zN̎v9*) EÐ5rN9ݟ*{ٿvCJtR-U;kwVoyp"{WBd S$BIs'kp&oF˘LЅQ%@pT7mG\Dd[FQc;urU7z߯jQ(&f>k?XqEUvuSR `4夰An;5&- NndQ7 ZmTڛ&^-r8p_?ޏm kËx.2SER: lmHYUdQ6])(MAPi.mGq;  G2wz 3ZU$!/ & -;b[DK놔:K㨇P.J1|fG쾪TdMlzu5?-cEE ^}Q@MJ3M?n'=.k`M#:IZyk,ˢ͎'h fH/!Bc\,#0lh?n'jL<`8{ Ƚv"r։={8' &2L6(4Q1ˣ`-, φ9q\rXЬi"=f1kˊCٛle{<)bWq0߯J^KHA^#eAa\g9 JdCI ˶>-_^.=٣bcQ%EMtUa)xGT5dИ]]B̮eN=jҵ,];h׶. e]C]\,2LDTMr55[R 2QM͞Wi@uw р0+'4d- ruQ0bŷVr .UX2DSi[)(eJ @Jqа+*erԬi0gA\t! `SҔR V~1_STnsԯsCtOX&7~X玔){n]\V奨,izy.]v&M\z}o\ ^NSQE{d;:4 i|喈[ABVn6UK"vqg"J7FUj ykY SdT!<ѹnA/uW /U3^ʈ@ OB 6[\!øCf ORVTn\TTxU,E^kB~q D&o_>3)mBh*d{HwskAb1 y}#N\o>b>]jB,ʆwi=6H惤osHWoR3އtբr D/@{8>u ӈ] м Bq)X/2`'PN$ŢQ/`ὝVtbM^)A'hpG4;J>R*Eɫ`&X }CE5"XE6UOmT'R%qv;a{5W=,Vݘs1+;S N쵴Hl.Cd@4Ez2rnj3k\u,͠l/6v8 Rˆ` ^βPY?y8iH#~NDp4\gPT֩dӣ)W̺O2Ҵ& /̉.Pp8y5ťn{2.OPFa\RUH[O1T0~@N}Ÿo?J%}BwW $wE Z0Kmo~?>}X4px6!k̦# 12Nd̲F&o{KZNC0$6rz4c뒌'=>nU9/Il ;ܑi)N(붦l '>N Ϸ{w2^q]ǽXWӡ0Z{E(oU\_7+pSΪnf?;Z'p]UNAe9l"?mGsx?u9G}x7L#>1_PZ05A(TsMt#7]FвHvݰ Dؘ9YuZtҲuudNs￷?_|??`p% a8.]~!v.4o_?Pu߿ݿܾK9<=rRy1X$_G|I~Dt1@ZL%C\d?n'{Hk5Lu-P O<%{ =WgZrcaާ E"ݿMa" "Uԣ 0 8OU=?RFWXs<9ɂl]|M=f>Fc#[]Ywsױ[67],IE:za\uh͏rqZ7T߸9 !>-`J &-c0t8 EZF(pidt_]#/*'4@5@,_??f(Qܛ-Z\7co'k0vD;9Z6G@*^ ^Y 'e8ePkq$VRw@r8oh]B3Nsq!&siY,)N!6ʦ c#ul[s3cl%9]R( hqMCKx˒,#tf.R{䖾u_EϫJ;WTdoс uںֱ_mмM}P&aɝ_mzH}MLh{x/VRe״PӒH}L FgPʛ'[;X? &Z3 ޱ5K6ͱ`YiakFX,&P0ȹ&4&\o"&TI>(UŨT|0RYk_|P9f4+zRQ `` ϸ|c~){-!Pd5DR4\A{#qH^+`veM8PvJ*bDҁɿMKHڨB!򸼡R !"۪;Я'_yI}I2=/a,-|lVݼ`/Tw7+%Mw_J>7{f4h([Z<2n,w6ZO[e$^l_GQ-7}`J wbj U 8-vphotf Kq@Wxuz)<3kY0ёv=^__u3c>-R0ev.ژ|If!깚׊*DKGFB٨ⶳ%wWjCQ=B*%rΊcHqUXCyICšt|euI.ܴj̽e:tcy\0uK/CTh Mw)`X,4 ZQ3?!4r-C0Fix}yV¹b"N Z ?0u>"`8Ed5Ւ6_GKL8H896ZVvu8Oc`7pb~8 $hw>m1w;$=?<48`N|KsZm9,V[lzQ(mNK7]-nVFoNϱUM[gB47[%V _O.4sFx {j>:j>@ze9Uj/D3C ҥR)U o! "YI}:K/O(};4 9@u'rϏ ԋdq9(Ez&"b܇ D716d e@UWGW.yF*QֿtLH=UʹXJDƅ ]ӥyE~ټՍv_;"$*Gޑx ")L*`1w􈄺n5q?\Ň4XyVCA8h:x0ۘsܢWGCgefa׮q#_ĵg7|yH=%J;H-feR^)iS:\U?JzDc">2S^rv޹C]̖L9'b)Š3VWhK_]SsEH"9E&tKp;1bbgw7Krx;d8FoNwo7l _3Z` ~@Wq:|=/Е^!YotG3Teecďٲ5[uX_>ܫ\23biP!j ZH gv ]%~̢3%j YM%=GX|bsu/c,u(suҧ,)55 /o~ ׏Mp.Uvjá: aK(F4Eq%+){ ʍEo0>5RezVFxY *WѮ̾uw0T=Zv_O&XP}͢(n>-fj!7ﴛ< >fH+ LgV,͐)+UjrfZ[0|}Lj#(TgS4f .|G)1XX*!lK@5_`H&hVG~_WUEҠͧww܀-C(Qu]>F![}#(;A#c,a6>qtcc]{@rCX=MTCr g DDON3YLc*7Ex s YmM>HDFp Q}VaHQ,cV >[ADqnٜ˘/1: $u^"/kl8VΫ$I }@eIpyOI?/hMAseU' 3p ~1a^RO}~?t=  g68ڧ뭄Kҋ.C27O+SފA<%4o;i/Hl- L93rCcJCAί|SGL8 J.\z6z0YMQ.#QtPo$Anq g2Я Ta8҈Â'2g .b`. +5QZ\d}lh%Υrȋa'n|c@YwEȌN;} T-(Z3uAjx+bM\ ?kSt#"gVBw1'*q ^!bV21aމA ɸe!F&)"ɑYMK .xx|qg\"gi%tWsUڻTx4i\=|BCoSRf_x*Ǻ:Uom /s%.ĽVߌD |TAВ\Yw -l(̹tFCk*~+yZ m|2rsW=T,ŬsޓফPhq_&Z8JYBs;$1{B{@-^ِi%m|mt=[7E貝u_0-QDZO=bL[TTɬ͡⥼&Ѯv:﬜܊Y$wTHT*'9A)\RrS)܆b-vDL&6]E"yjPrYP(1,OƘeZ:mٴȰdՈOWQ.lGgS -tgKC}M*ů <"gSuOxJOBQD2<_,"7}a$!Mn >畋ְR#!ZQham|؆*6+nќuc2ڳKc ӉX(:AF}"L.A 1ҩ-~O/NZ~xӟUl[]f aS*|+fGoiq6/5{Ÿsg샇.'WeTسooj4.z+E>vFEjDCJjO_\qkU7Oukx2 Dذ/\O@/Oݖ||h$|-6{x*>:ȭ:c>uhۈ;^ʐ&D( H܎o$7n !Gܹ*x=PO|s`獹!Ǧ1]_5Y)Fh:qj6C7UT1O-#&D0i壯^PBiQ%Jj @s0RcAv8Dh5ӻْJ"@f LY|mFwKNǙn,GNQ<%)};Z{(_ v5B 9&۵+f3Lj)k(zB,5bI6jC'>!OclQ&/~,TGRSUGu~E3Ϣu}"ޛ'agCn9^#bݪ.bGa{`=NM,RO (,bCʶ%tz 2F&&Un"G[-)'ϙ/IqAw]A$]SvG\\;_iū=\f_:a[BS52+@Ⱥƕ`#XI޸Xj*՚G, ǝtN.aB@2F׋j2Ii2fC˗Rkr-c$*vP7kgwAfOY!ေΙw"H$3VªA@8=39Ys~!B ,0l]k1&.Afs2&4hvCBosO`Zc1x~? sDV`&6UjADPv@3&!5隒!Dw/5{9g98qĤmҴKn]70զbpLoVJk*8-0z=u~YI:' Op@tP(]؈ >3{oQsNiIqrpL4ː6y=.ojw]h> N<~äi=dїMGlDayH!jGއ{H8sgǗuiS6yx3BXWJ'z8:^Fs< ٤'!{M:Epr L4}:zPom}hm=QvmԬ+0HE{qq;Zbp6)THZӾ}4Z |x:{դeMb9~'ުm _|bCw:]sx-WAP;׵$}=(~kgwK@\,WaU&4N?&ACy@oゞ8YP~U/B4!{(upON]G5#47] 3=WxVy$rgI FK+kqXy4nfG1Pc`0D1f'1wi*b? T/.Zm8Df*;-fQ ш}Xg0P`920&ߒ\4@g^u_Mx_"p*?z]gs~VͧYlbb͌eZ뺳ޒJ.diѦ܀ju|Yno4b`I~= ʎfڀ!d#0ҟjq`a4Ui9ؖx[£#9AY z }ZZ`waQD1VVw~rVY!y$'GFrfKX4:SQ#⨬[cFm"gS RCdu)Py"PP?n(0YwkQ^amxZf1ݩͻN^.n\յ9:a]z %8a-aˎ-؝llۿ`R5+GQGYJb6kޤfOe~>Z;lt,u;Uyl08kꖠfuyҞa 8Xs#tEaVň10LD}˜Y{tZ{L]X.gp o&܉ΡN!HkkZ*'G)9<[hkk|ĆsX6Ur(6ٮݍ'~QM%1 *BpBT%L[P{:;Ѕ{R ,˜36Q4Ž|$:'gc'K2grm Yw-'̈́΢M")B+tANbPAa0.)9%ԲfkBUZK2)91ھ'SDXعBo}?Ar/KKT9笻X 3-9WP#_57~P+7u_Ϋ$I@=<;)URXHbeTԖɧay 2q1UTǮj{kc{t>WzG#d<'UK{!]%a^¢r4<̧2`Svs=8d4' rjc29Nݓ,i| 9ЖkUVVw1G _acqjϿli)3vЦ)Ц q왟LOe/Y҂QAٕ}|hWdʮ}әf,N^b;ZsƧ @ 3(Q#¾~=Ÿz_7JP(Ŀ5P݃-tN;/ !&׌B՝h4 I]Q jMmޫe!mY\e%)M܏lYI$)d LFbf'>d9ΖZ9VSQrp'<ǭM |Gn:h[_(2 *o~0pjQ؆C!5\R)5z){4::t)Y@<Ғ#bf;d|oӊ0_'3VWl'NRu0UV5t#zs2=nZЯ(JY'TmB @$|E/&>lV \^hZP%Ggژl Nd)6_Ʒ'(K)1Dt VdtzҤv4/|7rB+b%5g8|<3 9d %+2ĹcWk& 5]zKXKu\[рw'O54KNqbb,4QyV.E~V "kFƇfAuС/|ЙG}\'aNn:˄FIK$뵲^QH( ~}n_tcEpK%D"Ci̟pN56c4EyVО!=$Y^Ѡ6N!C!%8OQ/خuutޙSl Y |;ůBb aHőN|v~ijPB1 #eh[p8]]2~I<bwt!:Xr*OLtR}$oL>~x0lP'9WC+1_J1( ;&URI*!䔗 PJk-8רQMuKj@SCiX "> Ƨ%&wαcϷ- %Y+ C8ύY|ruLF=Y'D oaʦY4AVeM؊t/kh\)gS2>7޶PXr3bռjp)C=?mmݪ=15tGuy`,#RU E3 qHg.XR!RC4CShHf;F! jCB݌e/ڦeRK's*pHK-})KE`ox+u> XcG(x ZPo^Y3@3^C]yp9RO>XoNm%,giO(/dkTYҩskdƂBڴ,5'0|uzP_T)*@k$3T3ͫ_ (5d:d,C^EP[ؖ&ނiƴ.wr9ҙkhh?)"]/bk,#|^Jkڨ-ʺA]Lݱ\>6,a9+oCv 3/ګҜAP:o 0QQZ@y J[놕Xsy<7ggĹ8glC?BB<ϳ R7h$)$y<I 6ܚ nŨY+,Lv.~iqNȳ"QGZq*Ox}ddL;FBtSsRByjY'leW4ژnt\k4RNUEj}/uk0/ ӳBBWGttHcJ1D' #zr̈qF$zLk+-k6^M?NM[k%ڴJ$zD8YZ>+ko:XRn~{βCT|Ybxq pΞ*"=i*d-4rPȘAa}nLJmACiHt7 v^tKi[3~rS>lwHOPw}B6zG^4Zq }ދW"mo|ç{S$PU2=e87*=*F_o3M j$~u׊R^:^tڌ7Z7Vi8RLmc҉)|W 9 UQHr wyMge&KsWK/gWDƷyNUg=se_Jx௕vѩebҙ"8"@P3ʱ|;7dd b.d076/ s ,y)RIS}HB8̥dL:uTGOLHw0|B47ϯPhҦC4 "b',ٚ.)8DK:9'HU4ět2Byfd`È>ur=9,,<0]RKGpJ_E2?y>W[Ÿroҍ̍u|0>(*i^Ut1֘6tʶD!ڍl^Zȃ6Y$@M Ѝl 1UMR;3IQF=+9'^Eޘ~Nڰ퟿ߡQEtȪ/д&5Rl']' _ch&Y|<tGp\Bd<ÁJ|52˘5~ ٢1&D>5 Xb=He$i -蒖 *Kj j:qڌ;wk |&-_qT.N@GwCBSPXqI`\kBTF]Hl;d1cS,-6q.^ScQdeA^2k+Yq#Ce 3)gI?h uGa Ti".:&4yl*=xp/"DT~^NMUE8Doi ZOZ@O@5KLv c0 p фXBѨZfIF;!@I<)אvQ6͹TFW0uhꖵE?m큍/k_4JB">FӬQR9I%͆a+6=UkiT&TLg1 .Uf!ylLê[vsdp67dȦ m6dž&YO 1oC .nȬ#$6}kԼfY*=Rg'R 5դT>KH]^u׆4H=(vfٙTZp&ݎH%L߿QasǂY[n5:j:e,Ӹ奚/Ɇ:<ڟ tzjD:ꪉ*)D5w; h(VQ*[~aN>"rV)GT&p_o)^q?/}K)}mp(fڊ`-bMSW1ᡍ6#wiJ:Ol6G᯷ޚe:VJ: md؊1 ,!~O<ӈ4i+X(YfY.;9ΟD FE _ID'5UbUV@ueȯYxe/"5s\rY6Gi} _ 9tC|'+lI0?FsYh m8&NLfo~ wl3`}yt9uMsBst;i JsDsMf:kFL9qL*}]乜ys 9-nn\BtpVi}q7;ޅu͖K%KP=TW0Džf2ufsywm~zҼl\iN' s[X cr*a2G^Y.r_Yr[oYe&gyY0LCDždD2Lioƅ kZ1i 4.hV 6jg +ʞ6,@-~XS]eCksi%4nt_q>9<5ui/Aw13 Ml!'ҋ@ ԧ= MSsO nVĆh6}v" s[srZ9j+bf&.&OGAsҼA/<^h=͡F^ڼsϢoa?GAbor75S|1o??Yؙ o/^>sUL\DN/Ѭ4gף*^6Հ{ª K mE\b>Ƿv|=g&]g"~v+ t bsx4&ٗNW@5WX,~_#oۇp09Jy +^b#1~:g>rπ9H=ūDx~tN," Ő=y"H9i uOX 秣#A ƙ#LijL M2k쐈Lht]˱-%CfAGk` J '[X<9'_7u &_ji&VZGN΋RejA*(:]OJ0VFxiKLtF%dO$B%|v󖫗;{тK|yֿta;o5q?[ &5p<+oz:Jye@6߯6TbMnm2:2 7tоI0,g?{G|3CihsW`nGW1r1CzV,2 56 2j ړ-ߴyAE6dx zS,߭Y'p@ߧD&f8+>v0s__vLc-X< gbk9jѠKزÄ[tddø DWAvx&6a*hнno4 D2x]z&d!jT_$@`Tƥʊ+ַx/os`8Ň՗UOKJnSؽ돺.1]j|1_}gd n%Jʶ ,j/PGt8cdQo$[$&ٵC fGVн]>cِG5d"\c]ƽ'aw4#] d]]h7)ƫoҐ ՘C8C1MܬTM T!V75UnZu_HKd`VrUposcj>6F 5J8]iʉQ`q rjeARHX"չ= qU %qhWe=uEˍVYuU il$H󥒃aʜnZq޷ĦD,˽^d.7* 8$4KS]~rzAXtOr1(Zl&^K^ote =/^ r)|4|2)ov"6d M_s-qx1H1rQ T~.Zu #y{)sEm>+daux!~3E91Q1QuPh5MvN3Q+ /Hghц~fiEM s+SlR,e(E3DG a"|Yl3}|Ϊ\/ڃ =aӻ`ų*8ţz-|p8C`̲POc\WyV.wyzOUuB$&Q> ,ӵkR%ѻ4o0aU8r$?~)t@5/4SL"K!շlIȗ S=]ok|oEj*ɈHf jJ- T Lnn]^buf u3Zgwϥ)hg)p!R̨^2^5ɱ8pS=1*gǬleT=H`(,BECQ ,g[Se6*o+-la< KZxR Kd%뢽~g+ߢMu3_>[Y0;-2Ki)YEGza ر.F{a;bϩ#*ct ir폨Q3ZDݏAHjs5MQo6eP( ~W E?e+-cQ"oW057Fg\]3E `pK!%rafw5:5:2vv[E[qr1N}F2'?>:!FMGKD.-KAMްCŲ3\? F FBrcsGtBY 兎w8,Og)Ѥx;& U+֕ #isV;C=+tI} 4V.҄Fhji- -1 3TFwI"׸ {X[E{)}f*&%^ZxO^ĩx'Lv L;WT: ”Y3_\/Tʪ, -VҋY0.5%(XsǬe#f"􏌦Ρ(e KhdߞE(DPWi9IS3PjjEPI4v[A_6L|Qgߕ""Uj^и"sKJ@bƀ͙v 3#ifYWI\瘫 +*K! T}G,M_PJBl -.uӜ_E#"B'_;35ӄrE1͑B1k|<"lqtjaFM}.Aq ,1]RB -wdrnfW$ @]-Dfg iftdZ(-b!4VTQޑo!sO~yۦF|e~Bڄ$A!7`hۜTFm~"B4{z۞sq7fI:+^6mޤhR|D2b$DcM]e.7$hZ k|R)[fkjoH1,B\  B!f0l^K?o!mqi}y6"2YnTma??"A'2؛4?pDm9dL'rW-\pyƎH;vG/ 9bwQhyvo BL<MH y"k cMpD}C)Q:8sR/"loD2z.kz>j@qL(0w+Hَ}$#=+x;h'?3j!lF[չgS x_ :h)MGѶ3YcO>;;Xn`? %tD'#2K 0''F"/"Px]\haD[OnA:f3uPl/KK׍}Q%ۢSE߶;rx<78`؃Id X}8w)E% w ~<Z8i(ݟw56*A͢-@I.Q`1-9&pkkL~eM_Sэ#ExHl#u1A ?_QN8 < mv"Tɿ$:^9#qD= Wko[7_Eu@@."m\C[#f {+)i%wS(lH䈏̙3@b ]w(EgFb A$FȘƻ8*'[8r>O4dI*,ѺHbI(wqtu0d%A wKbx]֘mSEI[B:6!-A]+S$@&<4$RN7IME uD? ҋ2wk,D$Q|eKv'IȽ@e{DGF|{,TԐ!id6Jp ܞy-Q!Q 7(yLVY7R3<ȠSJGq?6glޠz*aWќYpAEV}ܣigfݠ+kQY@Jk o-4\B\+nh-..կl˼;"(@ )-I\{TrRzڋ+Ni}F*g&oWVܬ8oCCտF__E]T.l98-[odD. C8ҾSeެ,>aeӭĕ0>))@§?Gc{| O{uD"I67<}Rxxp}>کH!BKt,#"a+ endstream endobj 3 0 obj <>stream H iVVfjfeX`VQPA\ sd󘬕&z&D:QSzC|:m}wuvj}M7O-lR*%)Y`3FueMdXK*RWp"~ oc]xo:pEn + v 8u85lEآKUYYq== MdG_W-)ZuN]N>stream H I0wllBxLNNUWg|Kw<. ?y+O:Hwɭi3zKE0KI0 %S endstream endobj 5 0 obj <>stream H nPuAqC\5mA\{St/~V}_kuQVYe%-q݉b+,"[E2ɔ.kW/)(7)(3)e J(1(fNј"B6`@A|#_S u &11j0`C>=<3=EkBNO M !CA0`>{1.pp `?S驥-N*.G endstream endobj 6 0 obj <>stream HƉ2BQ'BȖ%\U<9s9w3|ۿ]uk&kqA] ]?_pkmZ@ c+ӯ>HU8edeWaG;llʒO6*Va*ZyZ,rK ED#P4)=K)7JMS(9I 8.1s'7`C䆃?;XXEEzGf endstream endobj 7 0 obj <>stream ھ׹ؽֹոԶҳѱаϮάͫͪ˨˦ʥǢǡǠƞşŝěÚ}}z{zyxwvvurtsrponkmlkjhhdhedbb`_]][ZXXWVUUTSSRQORQONMLJIKJHGFEDCCBB@?>>=<;:98766654322100/..--,~+~*}*})|)|( endstream endobj 8 0 obj [0.0 0.0 0.0] endobj 9 0 obj <> endobj 10 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; I  1R %a!"#$&'()*23456789:ABCDEFGHIJQSTUVWXYZbcdefghijqrstuvwxyz?UUU(KNUc1AK4AA\lDE>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/24S0BsccCK=3K SKCs#=C 3cS#\.}\|@.\ endstream endobj 12 0 obj <> endobj 13 0 obj <> endobj 14 0 obj [0.0 0.0 0.0] endobj 15 0 obj <> endobj 16 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; K Q !"#$%&'()*123456789:ABCDEFGHIJRSTUVWXYZabcdefghijqrstuvwxyz?Еѕ+ϴCҕ1*4*UI# . qa6 䐠?ӕ_JH̍`TE af$rԕ^$#;8w=2,XhSb%|Ci#7Jn;)* vRTp줨&IPMòe%A7Jn;)* vRTp줨&IQ]SbI%B'RsBJ$ՕJ"QY<#jA-Ԃ[={R lH%ڐKg jA-Ԃ[={R lH%ڐ% !$๱(ˎ֕וЕ endstream endobj 17 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/24PA]sScC=sSsKCC3S= 3 \.}\|@.f; 2 endstream endobj 18 0 obj <> endobj 19 0 obj <> endobj 20 0 obj [0.0 0.0 0.0] endobj 21 0 obj <> endobj 22 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; > ,oQ !"#$%&'()*123456789:ABCDEFGHIJRSTUVWXYZabcdefghijqrstuvwxyz?UUUZ0Uc$RDÉċr< L85ЕDdH 0" Vh4Ub*fX@,EY" Vh4U'db(UTrH HD g&RDĂ$Qшɉɉɉɉɉɉɉɉɉɉɉɉ;YTq"@@9G"D?UUU endstream endobj 23 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/24T0B]3#cS =sS3sCs=3Ks#3S3\.}\|@.h G endstream endobj 24 0 obj <> endobj 25 0 obj <> endobj 26 0 obj [0.0 0.0 0.0] endobj 27 0 obj <> endobj 28 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; 9 (sR !"#$%&'()*123456789:ABCDQEFGHIJSTUVWXYZabcdefghijqrstuvwxyz?UUUgP$3%%PZE)j R@ (KTQ2e-QDZE)j i|I<aJK)4JPUDgI bf*1TDU:$b 3NtH S@f*1TD *MHUUU endstream endobj 29 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/245V0BSscS= C#s# 3=KKC3\.}\|@.Z endstream endobj 30 0 obj <> endobj 31 0 obj <> endobj 32 0 obj [0.0 0.0 0.0] endobj 33 0 obj <> endobj 34 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; 9H NS !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?*** Ģ'NDDB+B0* H@@* S N,D1!(f(:L3qf" xB"* A80DD@&S DN'&*** endstream endobj 35 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/27R0BSs =CKSS3S=K3SSs3#\.}\|@.Q endstream endobj 36 0 obj <> endobj 37 0 obj <> endobj 38 0 obj [0.0 0.0 0.0] endobj 39 0 obj <> endobj 40 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; >> NS !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?*** 180@)SD * 1p@AD5-)BBR@ӣeHY 0SL ?*DDD<񲋑d)bA0 e 2"DqRP*** endstream endobj 41 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/23R0B eljgjddiha`hjdX)$r{(srZ| endstream endobj 42 0 obj <> endobj 43 0 obj <> endobj 44 0 obj [0.0 0.0 0.0] endobj 45 0 obj <> endobj 46 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/23R0B elbg`bji`hjgddibid˥k`C. endstream endobj 47 0 obj <> endobj 48 0 obj <> endobj 49 0 obj [0.0 0.0 0.0] endobj 50 0 obj <> endobj 51 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/23R0B ellgfna`n``hbg`jdbi`˥k`X endstream endobj 52 0 obj <> endobj 53 0 obj <> endobj 54 0 obj [0.0 0.0 0.0] endobj 55 0 obj <> endobj 56 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/23R0B el`gdlj`nf`hlg`a`ldd˥k`YJ endstream endobj 57 0 obj <> endobj 58 0 obj <> endobj 59 0 obj [0.0 0.0 0.0] endobj 60 0 obj <> endobj 61 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/23R0B elhgd`jhfi`aghlafnh˥k`Oy endstream endobj 62 0 obj <> endobj 63 0 obj <> endobj 64 0 obj [0.0 0.0 0.0] endobj 65 0 obj <> endobj 66 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;;@ L Q1! "#$%&'()*23456789:ABCDEFGHIJRSTUVWXYZabcdefghijqrstuvwxyz?ʀʀ|_:3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɛ7&nLܙ3rfɬY/kPʇCٓlW&3Þqd>nB4.B4.B4.B4.B4.B4.B4.B4.B4.B4.B4.B4.B4.B4.B4.B4.B4|MhY8sՕf>ʈ{2#U}epV 9;F瞌2hhɡ&2hhɡ&2hhɡ&2hhɡ&2hhɡ&2hhɡ&2hhɡ&2hhɡ&>4d㕴l؛Gp);1ßSbl=GcQʈ6N+.՘s+$ejlݛh[FDv.(h↋.(h↋.(h↋.(h↋.(h↋.(h↋.(h↋.(h↋.(.(hZ8kUcWdYlM0NjLԙ3RfI5&j_|ND'%ʟ1YgfÑ0F ]GeYbb6N[`S؋PE PE PE PE PE PE PE PE PE PE PE PE PE PE PE PE PE9V(kj`{GdGcpgq:>UhM йM йM йM ЛdN]c={ Qzʟ98sGh;]aƤ9Q`3f 30f`3f 30f`3f 30f`3f 30f`zv%'>q6NZ8ݍ_4}\44\sCE 44\sCE9[El}-b-}n6.FCʟ98sGcݴOv>`|h"vNm.ё29qxʟ98sGcݴOv>`zK՗"xsՕe EHtHtHtHt<6%50q֫,DNm#g:;Re׭y:.7bbʟ98sGcݴOv>`־5f7n 3pfbl8qԗ\O"5%ղ6r./Xʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8f{I.26el\^ʟ98sGcݴOv>`ؘ8^I.26el\^ʟ98sGcݴOv>`ؘ8^I.2el\^ʟ98sGcݴOv>`ؘ8^{I.2el\^ʟ98sGcݴOv>`ؘ8^{I.2el\^ʟ98sGcݴOv>`ؘ8^I];iIˬqqzʟ98sGcݴOv>`ױgd[)uRIl֭qzʟ98sGcݴOv>`}ݱ"]ci=7RKb̺/VeIټʟ98sGcݴOv>`3/Vqp;HZ"vnWWf6폫2>^eKʟ98sGcݴOv>`|LYyzVp^Nu}WWf;VeLYzdʟ98vpv;fYx;UbƤ9Rf64j3gA=z 3gA=z 3gA=z 3gA=z 3gA=z 3gAVLJ֘-;7]Bݎ֭]]ufvn3bMYz2Uʟ1l ÙMIf7cj;%r[b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_b*_bۢV]*V|jNmvnٸ]Vgf6՗xʈ}.F˱u&׭ٹ67{JDF/tm+4TґSJEM)4TґSJEM)4TґSJEM)4TґSJEM)4TґSJEM)4TґSJEM)4TґSJEM)4TґSJEM)4TґSJEM)4TґSJEM)4TґSJEM)'iXӱ6i=X!p^Wf66ƙxHʈ{2'Qv}j 1c'iSSIMM%54SSIMM%54SSIMM%54SSIMM%54SSIMM%54SSIMM%54SSIMM%54SSIMM%54SSIMM%54SSIMM%54SSIMM%54SRvy[H__bx{lk\}_[//UʇK'/QڏfMc5|j^j^j^j^j^j^j^j^j^j^j^j^j^j^j^j^j^j^j^j^j^j^jThVVřz^3/ʀ|tukɯ_&M|5kɯ_&M|5kɯ_&M|5kɯ_&M|5kɯ_&M|5kɯ_&M||kjʀ endstream endobj 67 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/55P0B]cc#Sc=#Scs#cCSK#=sS\.}\|@.M\ endstream endobj 68 0 obj <> endobj 69 0 obj <> endobj 70 0 obj [0.0 0.0 0.0] endobj 71 0 obj <> endobj 72 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/23R0B ellga`jd`f`aghlafnh˥k`O] endstream endobj 73 0 obj <> endobj 74 0 obj <> endobj 75 0 obj [0.0 0.0 0.0] endobj 76 0 obj <> endobj 77 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/23R0B eljgjddiha`aglbiajl˥k`P endstream endobj 78 0 obj <> endobj 79 0 obj <> endobj 80 0 obj [0.0 0.0 0.0] endobj 81 0 obj <> endobj 82 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/23R0B elbgajilbb`bgban`f`˥k`P5 endstream endobj 83 0 obj <> endobj 84 0 obj <> endobj 85 0 obj [0.0 0.0 0.0] endobj 86 0 obj <> endobj 87 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/23R0B elagnni`dd`fgbdifan˥k`P endstream endobj 88 0 obj <> endobj 89 0 obj <> endobj 90 0 obj [0.0 0.0 0.0] endobj 91 0 obj <> endobj 92 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; ? 1 !"#$%&'()*23B456789:ACDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?UUUeL KJH6!H&eJA"F(XpK$HB_f\"Z@UHȂ A0Cx;Nr BkhĐB5>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/24T0B3cCc=CKKKBr.gK>W @g > endstream endobj 94 0 obj <> endobj 95 0 obj <> endobj 96 0 obj [0.0 0.0 0.0] endobj 97 0 obj <> endobj 98 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; ? >c !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?UUU$B1  GHЂ$ ULIMrRU2@I9pfJMMHH*TDސB@,IRR1h%"~F# g!BA҅4PǜF!" 0UDF6ЃT1[b$RAb1J#$+WTE HBE5] `\R$r1bUUU endstream endobj 99 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/246U0B3cc=cK 3KCCsS=K33sc3\.}\|@.g/ ? endstream endobj 100 0 obj <> endobj 101 0 obj <> endobj 102 0 obj [0.0 0.0 0.0] endobj 103 0 obj <> endobj 104 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; ?  !"#$%&'()*12AQ3456789:BCDEFGHIJRSTUVWXYZabcdefghijqrstuvwxyz?UUUޥI$I)܈y*Hb K %DdhC)%ItB_t UTdA Cy ԎAseEUAA4>IVh˛RW%I("(Ib ih I*A$ $R I I &n% & `\RI c@$LD@PLҴ%@KI$UIRNA/]J'I)^fpbH f !M$BnH%T"MP&*t#.b,̹%3H$bF;$KI%{6,dt/$*,)3CT%z\!!YT.JI%TPUUU endstream endobj 105 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/24T0B3cc3=C SBr.gK>W @d ! endstream endobj 106 0 obj <> endobj 107 0 obj <> endobj 108 0 obj [0.0 0.0 0.0] endobj 109 0 obj <> endobj 110 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; ? } !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?UUU$,KB@\a" $ ULs*\$$+)T8$Ar`ԎC8v0 ?{&a $BN$  X, ;)RAS ab ,`uJC ts(IrLbK$GrNdC x?UDdR !vHә 5;Y!ùԡOdND1ġk"U$E"y;\Ƌ@:*ad_NC% wIŏӱ'BE?UUU endstream endobj 111 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/246U0B3c3C=SsS##S C##=3C3sK \.}\|@.fr 5 endstream endobj 112 0 obj <> endobj 113 0 obj <> endobj 114 0 obj [0.0 0.0 0.0] endobj 115 0 obj <> endobj 116 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; > >c !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?UUUr) JHR@%H"4! hBHЄ"ULIB*WI=&bTe ryȐhh$#$ȩ$ĎTho47.BRR!<*A5$1 h"&BhKGUDBm! !Ҍ+99(!F! dr1 DWrz@@ho!JOHHƦXWz@@ho!X!"RF'dNB9ԄPUUU endstream endobj 117 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/246U0B3#Ss=CKKKcK3K=sc3 SC\.}\|@.]  endstream endobj 118 0 obj <> endobj 119 0 obj <> endobj 120 0 obj [0.0 0.0 0.0] endobj 121 0 obj <> endobj 122 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; > " !#$%&'()1*23456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?UUU'&JPu#ْ)G%j@P$ &C `Q %@UTr! BJ&{4CT;zH IlQH2& KDGaR 3)H AQJGt@cJA4eJ A* (JUI uCP  hl~*42, f~4c(t~);!t2Q9!ys*2(̑OYDCs%h"'s΅F4UUU endstream endobj 123 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/246U0B3#sC=3Sc3S3C=KKC# \.}\|@.Z| endstream endobj 124 0 obj <> endobj 125 0 obj <> endobj 126 0 obj [0.0 0.0 0.0] endobj 127 0 obj <> endobj 128 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; >  !"#1$%&'()*23456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?UUU)J$d!ˆ*E*eE(MH 4GRMHԀ!et!D&l( d^,UT! %BJ馛܆\6j\#򙊚h|dL!ԅ_)H0s)$)i4:*K&)ɒ#q 4NJTAK1̔*D;/pSe)|YȼhUI) ꦧ9Sh )3SHTD?/(eyyF,O"(2'yDO%"2>J#DQ"|WOQ*p@/_*UUU endstream endobj 129 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/24T0B3#3s=CKKKBr.gK>W @]  endstream endobj 130 0 obj <> endobj 131 0 obj <> endobj 132 0 obj [0.0 0.0 0.0] endobj 133 0 obj <> endobj 134 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; ? %u"A !#$%&'()*123456789:BCQDEFGHIJRSTUVWXYZabcdefghijqrstuvwxyz?UUU$ DI N qAD  @ULS@dHϑB(rh3L H2c0$CB 04*R ę^0*`$bPH2)QA`W 'F%$(%"% )xdUENAD VDҙ #PAJ 3ET MU P+#U@$MJ >H?UUU endstream endobj 135 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/246U0B3cSK=#sSS#=CC#3s3\.}\|@.Y endstream endobj 136 0 obj <> endobj 137 0 obj <> endobj 138 0 obj [0.0] endobj 139 0 obj <> endobj 140 0 obj <>stream AdobedC  "$*$ $+(( $)%%1/%).*++9+*./45554/;;;;;;;;;;;;;;;;;;;;;=  ^C !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz??Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ?ժ?֪?ת?Ъ?Ѫ?Ҫ?Ӫ?Ԫ? endstream endobj 141 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H 1 @ D^ȚV@HR!WHThG95_4ͳ)l3p k~{H|6Yt 0X- endstream endobj 142 0 obj <> endobj 143 0 obj <> endobj 144 0 obj [0.0 0.0 0.0] endobj 145 0 obj <> endobj 146 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; @s  ! "#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?U?U?U siJ1*NjҚR e"Uf"RDD("Q" ( HtSM)ZQyI%IB"OMʳB);5XVkSUbkE"M( \B)IMRSTi)@A$45q!e|AD@U E ZG"R8J ?Uy)*IVHF(1@D0)U#U?U? endstream endobj 147 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/244U0B3cSs=sKK CSc=ScKS\.}\|@.g| < endstream endobj 148 0 obj <> endobj 149 0 obj <> endobj 150 0 obj [0.0 0.0 0.0] endobj 151 0 obj <> endobj 152 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; Hq !1 "#$%&'()*23456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?U?U?UUTU L3!(B A[$!<"@Qh?UD>="f 1HsTnj" RBTQ!QTDH:6v>~"UTD)NQL!Fd:E2!)7YLtd CS"Qt8HUS+UGOGk"ʬhPUL`QUcRXԄV5!(HJcRXԄJU?U? endstream endobj 153 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/244V0B]s#cKC=3C #SS3C#= cs#s\.}\|@.p [ endstream endobj 154 0 obj <> endobj 155 0 obj <> endobj 156 0 obj [0.0 0.0 0.0] endobj 157 0 obj <> endobj 158 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; Rs ! "#$%1&'()*23456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?U?U?UfNO JQ& " D()P0S`!@OB RS%BULə EZa!!4m4R$"uH* U @@'QT*"ҝ6B%H-d!z*SUUA_H͚4e!R(itx OxF(Dz1@=0)]EUUA_H`J@ϟHULK (QyH-sҥ<4YUIi%P"U?U?U? endstream endobj 159 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/244U0B #c3=Sc KCSc=cS#S \.}\|@.e + endstream endobj 160 0 obj <> endobj 161 0 obj <> endobj 162 0 obj [0.0 0.0 0.0] endobj 163 0 obj <> endobj 164 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; 9 (sR !"#$%&'()*123456789:ABCDQEFGHIJSTUVWXYZabcdefghijqrstuvwxyz?UUUgP$3%%PZE)j R@ (KTQ2e-QDZE)j DT-IR [EВ%BLMOUDgI bf*1TDU:$b 3NtH S@f*1TDU:$D'RUUU endstream endobj 165 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/24P0BSsccs=3c # KC#=SSK CS\.}\|@.hy C endstream endobj 166 0 obj <> endobj 167 0 obj <> endobj 168 0 obj [0.0 0.0 0.0] endobj 169 0 obj <> endobj 170 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;; C  }QR !"#$%&'()*123456789:ABCDEFGHIJSTUVWXYZabcdefghijqrstuvwxyz?UUUpRI"ԾHRa =K鄀/ԾHRa =K鄀/ԾHRa =K鄀/ԾHRa"pRI?UjR!lHAYAAe:jH@!:jH@!:jH@!: QQQ+D3M1I1 /HQtr\*)HHU e/D@]N$bq ;SغH@v.u8Ā]N$bq ;SغHEepI$'&Y2 E¢֢#b]PTVIR QpJR\1y5JI `JZ*$?UVl E lJ6e2ҋEd_/VHJ+`UUU endstream endobj 171 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/22T0B3scCC=3#S3C#S=S s#c\.}\|@.e % endstream endobj 172 0 obj <> endobj 173 0 obj <> endobj 174 0 obj <>stream H4T{PTww^2 b\WЩ+F( di!&6UTBQ"QpP| &m:ⁱKwcaYIQ&}ܼ!"N!¸/˜k^j򔔬BZe/b~JҎsc L+Ʃs?lL Bi9MюOcQ_}%kTdŴ*Z\<W]kȎd'gdm܃NEMN4XJQ=؞Dk>hkWaz(S?ȹӦڋĢ >Y'HdʧŒgqc͍̤ЊZ/ݫk.LO<%rԢE̸eLup@x5S25 wsAՒ>o"HN/eKJc J?H cOQ¡نx8?>{p/d}|dQ[DJ߽M;>I9\fvеo(ܓX"`jvHiA7oЂ(U;iattuFPas%LgLȧ8\Hm.4G mFD 7GǧZ~1롎tR0X/u.5fۃ=RDj&&o@V냶p+L^j*:cI:.f,d[l'i\ZO4+*M4P9 ~ru,5N^~W('ҴMl Q{Xz-܌w:g84,Eぜuς[y^0smAx +gnR=R.r_.e{x<UdX חڂ܉P(OBHoauz ?ﰷpWҀ?[+ endstream endobj 175 0 obj <> endobj 176 0 obj <>stream H\j0 ~ COSXrit1NzOJ3$%YrTV0ˮ4| ފ$o*ۡq"zf*ۍ"el D ^WYdTߜ,cY@4@F!m]e9u2h`rM WyG!K~7^)1N%sI|d>"gI`760N"W(F)1+WsF̹*jfMc1{*TSOgf,BMf7Mn4iv"fM>{rN$ EWʍB>z޼6G-<^,į$ endstream endobj 177 0 obj <>stream application/pdf stripes_product guide 2012-09-07T15:50:36-05:00 2012-09-07T15:50:36-05:00 2012-07-03T14:30:58-05:00 Adobe Illustrator CS5 uuid:26608696-4dc4-5645-bca1-5499576d0e7b xmp.did:02801174072068118C14B223EB52A9CE uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:b3d371e2-a28b-cd4f-9369-1deffe06b719 xmp.did:01801174072068118C14A3205A45E773 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:F77F117407206811871FEEFC10EB4007 2012-01-09T16:49:32-06:00 Adobe Illustrator CS5 / saved xmp.iid:01801174072068118C14A3205A45E773 2012-06-29T08:11:18-05:00 Adobe Illustrator CS5 / saved xmp.iid:02801174072068118C14B223EB52A9CE 2012-07-03T14:30:56-05:00 Adobe Illustrator CS5 / Document Print False False 1 1224.000000 792.000000 Points Cyan Magenta Yellow Black Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=60 Y=100 K=0 1 CMYK PROCESS 0.000000 60.000004 100.000000 0.000000 Adobe PDF library 9.90 endstream endobj 178 0 obj <> endobj 179 0 obj <>stream application/postscript Print 2014-04-15T09:26:32-05:00 2014-04-15T09:26:32-05:00 2014-04-15T09:26:31-05:00 Adobe Illustrator CS5.1 xmp.iid:F77F1174072068118C14ED45152AAC1B xmp.did:F77F1174072068118C14ED45152AAC1B uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:ae9148ef-3000-a144-9ee3-ddb3557e196e xmp.did:8AF5709C0E20681188C6A12CE4B46A4D uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:F77F1174072068118C14ED45152AAC1B 2014-04-15T09:26:32-05:00 Adobe Illustrator CS5.1 / Print False False 1 11.000000 8.500000 Inches Cyan Magenta Yellow Black Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK Red CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK Yellow CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK Green CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK Cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK Blue CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK Magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 14.999998 100.000000 90.000000 10.000002 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000004 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000001 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 19.999998 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000002 100.000000 10.000002 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000002 95.000000 30.000002 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000002 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 14.999998 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000001 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000004 100.000000 35.000004 10.000002 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000002 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 19.999998 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 39.999996 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 39.999996 45.000000 50.000000 5.000001 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000004 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000004 65.000000 39.999996 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 39.999996 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000002 50.000000 75.000000 10.000002 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000004 60.000004 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 39.999996 65.000000 90.000000 35.000004 C=40 M=70 Y=100 K=50 CMYK PROCESS 39.999996 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 Grays 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999405 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998795 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999702 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999104 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999401 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998802 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999701 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999103 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998803 Brights 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000002 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000002 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000004 90.000000 0.003099 0.003099 Adobe PDF library 9.90 endstream endobj 180 0 obj <> endobj 181 0 obj <>stream application/pdf Hitachi_TM 2007 Adobe Illustrator CS5 2012-02-20T12:01:19-06:00 2012-02-20T12:01:19-06:00 2012-02-20T12:01:19-06:00 xmp.did:B0CA962109206811871F8A4B9F8B6BD2 uuid:6810747c-3e4a-5a4b-aefe-0bae8ccc3d10 uuid:29EEF1EB347F11DDA7A0B5DDEB6F260A proof:pdf uuid:1a3162a5-da51-4a51-a155-35526b76f090 uuid:29EEF1EB347F11DDA7A0B5DDEB6F260A uuid:29EEF1EB347F11DDA7A0B5DDEB6F260A saved xmp.iid:B0CA962109206811871F8A4B9F8B6BD2 2012-02-20T12:01:17-06:00 Adobe Illustrator CS5 / 1 False False 11.000000 8.500000 Inches Magenta Yellow Black Default Swatch Group 0 K=0 GRAY PROCESS 0 K=100 GRAY PROCESS 255 C=0 M=0 Y=0 K=0 CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 K=100 GRAY PROCESS 255 C=0 M=0 Y=0 K=0 CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Document Adobe PDF library 9.90 endstream endobj 182 0 obj <> endobj 183 0 obj <>stream moqopsqrurtvtvxvwzwy|y{}z||~~ endstream endobj 184 0 obj <> endobj 185 0 obj <> endobj 186 0 obj <>stream Hju(#l endstream endobj 187 0 obj <>stream H @0b3k?fW(Iwͣѱz{w7,$9J8rpTsTqT`8g88$-Oj endstream endobj 188 0 obj <>stream HlI0гBE8 RŻ NQ—H{E 5(;5oxKPf@=}vh[^xPY{ʪ%.]p!#>stream H>PFxTu endstream endobj 190 0 obj <> endobj 191 0 obj <> endobj 192 0 obj <>stream H\y(#a endstream endobj 193 0 obj <>stream p!q"r#s$u%u'w(x*z,{.}0~2368:<>ACEGJMORTVY\^`cehkmprtwz|ÕŘǛɝˡͤϧѪӭձ״ٷܺ endstream endobj 194 0 obj <> endobj 195 0 obj <> endobj 196 0 obj <>stream H4EPFbmA endstream endobj 197 0 obj <>stream H?re(zA⿧@tѹςУĿ=8?wϭ=nsck\?9יNulʯ?t}g7~[uE̗%_ii>@_- endstream endobj 198 0 obj <>stream o#o#p#q$q%r%s&t(t)v*w,x-y/z1|2}468:<>ACFIKNQSVY\_behknpswz}šŞȣʦͫϯӴշؼ endstream endobj 199 0 obj <> endobj 200 0 obj <> endobj 201 0 obj <>stream H4YPF)iA endstream endobj 202 0 obj <>stream H Bo0~ ??ͭ}ysOOu硖{(9뚨},>stream o#o#p$q$q%r&t't(v*w,x.z/{2}4~68:=?BEHJMQSVZ]`dgjmqtx|›ŠȤ˩ͮѲԷ׽ endstream endobj 204 0 obj <> endobj 205 0 obj <> endobj 206 0 obj <>stream ܿڼٺط״ղԯӬҪЧϥ΢̠˝ɛȘǖŒĐ΋}zwurpmkhfc`][WUROLJFC@>;852/ endstream endobj 207 0 obj <>stream o#o#o#o#p#p$q$q$q%r&s&t't(u)v*w,x-y.z0{2}3}479:=?ADFILORUX[^behlosvy}ÜơʦάѱԶ׼ endstream endobj 208 0 obj <> endobj 209 0 obj <> endobj 210 0 obj <>stream Hʿ /A endstream endobj 211 0 obj <>stream o#o#o#o#p#p$q$q$q%r%r&s't(t)v*w+w-x.z/z1|2}4~67:<>ACEHKNQSWZ]`cgjnquy}ÛƠʥͫаԶ׻ endstream endobj 212 0 obj <> endobj 213 0 obj <> endobj 214 0 obj <>stream HhA endstream endobj 215 0 obj <>stream o#o#o#p#p#p$q$q%q%r&s&t(t)v*w+w-y.z0{2}4~57:<>ADFIMORVZ]adhlosw{ÜƢʨͭҳչ endstream endobj 216 0 obj <> endobj 217 0 obj <> endobj 218 0 obj <>stream ޾ܻڷٴְխөѦϡ͞˚ɗǓŏË|wsokgb^XSNJD?94/ endstream endobj 219 0 obj <> endobj 220 0 obj <> endobj 221 0 obj <>stream վӺѷϳ̰ʬȨƥá辛缗湓巐䴌䳉㰅⮂|ߧxޤuݢrܠo۞kڛhٙeؖaה^֒[֐XՎUԌRӉN҇KхGЃD΀A~=|9z6x3v/t,q)p&n# endstream endobj 222 0 obj <>stream H:|t(#eU endstream endobj 223 0 obj <> endobj 224 0 obj <> endobj 225 0 obj <>stream ޻ܷٳد֫ӦѢϝ͙ʔȏŊÅ{vqke_YRKD=5.& endstream endobj 226 0 obj <> endobj 227 0 obj <> endobj 228 0 obj <>stream ݽܺٷشְխӪѧУΠ̜˚ɗǓŐčŠ}yvspmjgc_\XTQMJEB>:73/ endstream endobj 229 0 obj <>stream /01234689;=?ACFHJMPRVX[^adgjmorvy|ÌŐǓɗ˛͞ТѧԪծسٷܼ endstream endobj 230 0 obj <> endobj 231 0 obj <> endobj 232 0 obj <> endobj 233 0 obj <> endobj 234 0 obj <>stream p!q"r$t%u'x*y,z.}1~369<>AEHJNQTX[^adgjnqtx{~ÛşȢʧͪϯҲԶֻپ endstream endobj 235 0 obj <> endobj 236 0 obj <> endobj 237 0 obj <>stream ݽܺٶس֯ԬөХϡ͞˛ʘǓŐč~{wsplhd`\XSOJFA=84/ endstream endobj 238 0 obj <>stream Hd½ AQ?hm6f1Y,E@R $"G\q=qY==?}_ o`x uG Vt]eN)Ǥ Ч}mZ7iUee9+I^sr%D7&: F/yȻYŲNv]OUZԈY > qK endstream endobj 239 0 obj <> endobj 240 0 obj <> endobj 241 0 obj <>stream H|¿ Q?l6Ff3ٔb`E"ꆋ]]~uuwݷݧ_-00I`Q>7.2D/3G`jTᾁ 3yPrו"Ԗ6ĺƗU>iOJ˳N*YΐfS鄪< endstream endobj 242 0 obj <>stream /024579;>@CEHJMPRUX[^adgjmorvy|Ëŏǒȕʘ̜ΠУѧԪծײٶܺݽ endstream endobj 243 0 obj <> endobj 244 0 obj <> endobj 245 0 obj <>stream ݽܺٶزծԫѧТ͞˛ɗǒϊ|xsnjd_YTNHB<5/ endstream endobj 246 0 obj <>stream ޾ܼڸٵױծԫҧУΠ̜˙ȕǒŏŠ|yuqmiea]XTPKFB=84/ endstream endobj 247 0 obj <> endobj 248 0 obj <> endobj 249 0 obj <>stream H4c(#k endstream endobj 250 0 obj <>stream Hl P߷ܟ4S=$$*(g<0J ~cdǩRYTHPlfk0e!8I -@RXY-WumHS1-Ͳuoq7hM?[`pE8z?$i~5J~ endstream endobj 251 0 obj <>stream H0i2@q-dmm]u^iiǡۦjꢮ2-<4L $ȍB' Pہo鹆"[-2EL:kTQdZ(I$%\俐/<n4y EID8vv; endstream endobj 252 0 obj <>stream H} YA endstream endobj 253 0 obj <> endobj 254 0 obj <> endobj 255 0 obj <>stream H2oᔡ tt endstream endobj 256 0 obj <>stream H[P{R:n*e.\-1/z>b?q%8Wp8 Q])AH +@xUM-h˦v3lk#?x,jFh89ΗHɲ<Ͽ EH endstream endobj 257 0 obj <>stream HB^(2C"2B%ﺮm4MzUϪGY#˳4K4{toqFap z |zq}ܳXm-6uLhh~R4U>)*AA%w[gۮy6g՚\J Qp>stream Hڰs놡 = endstream endobj 259 0 obj <> endobj 260 0 obj <> endobj 261 0 obj <>stream Hx̡ lcx endstream endobj 262 0 obj <>stream H @KuԬL$HZH*J𐗼ڜ:x 2pm ANj}R@P2FRYYʘSuA3n"c"b9ӹ9w"\-8h&mpz,Ui ه endstream endobj 263 0 obj <>stream ʿȽǼƺŹø¶ endstream endobj 264 0 obj <>stream HZi⡌ Ё endstream endobj 265 0 obj <> endobj 266 0 obj <> endobj 267 0 obj <>stream Hxġ wA endstream endobj 268 0 obj <>stream H[PmIZiˬa9O}%^sE>e*Pe5&- G]IAhEgT@DcMY:w53v A.qr8^z?'^ endstream endobj 269 0 obj <> endobj 270 0 obj <> endobj 271 0 obj <>stream HZa󲡌 A endstream endobj 272 0 obj <>stream H B`Gus!$rRto۫tJV0`7N C]Q,Lsá,8E\蓢DeZRy**?Upj5ǎa#׳=?da.(&ƛxp:.K$ifY|?W_  endstream endobj 273 0 obj <>stream þ endstream endobj 274 0 obj <>stream Hj0y(#|)h endstream endobj 275 0 obj <> endobj 276 0 obj <> endobj 277 0 obj <>stream Hڲiۖ 殇 endstream endobj 278 0 obj <>stream H 09-ge*Y 1#!^~ :eչ+P 5,# MSX԰i[q,ϵ0>|< QqNV4ɲ4Ů(}uS}ͭi{98NG`4? endstream endobj 279 0 obj <>stream H‰D ]9D3myǸ[?8N}ߏmuۖue6iVjQ)NʶMۉkQeUee:g, 㔥4a1MHD($! 0AA# Q}AzBxv--e : endstream endobj 280 0 obj <> endobj 281 0 obj <> endobj 282 0 obj <>stream H?o &w endstream endobj 283 0 obj <>stream H|K @_"8ʨibedb$Gnl5iQ-P77Y498ɋ@ e$%ȒȚ`Mձfcevmqlu7|0D4$IiVynv(N~{峪~B endstream endobj 284 0 obj <>stream H0JQl 2UNO8-:/4x0az¦uVuSUQVyQfyfyfqFqFq~z~zZcZ0mP5CtY%YK(ɼ(ƋM`8b8fI4qD\ [$ endstream endobj 285 0 obj <>stream H J endstream endobj 286 0 obj <> endobj 287 0 obj <> endobj 288 0 obj <>stream H>EPF.j endstream endobj 289 0 obj <>stream !#&),/258;?BEILPSVZ]adgknqtx{~Äƈnjɏʒ̖ΙНҡԤը׬ٯڴݷ߼ endstream endobj 290 0 obj <> endobj 291 0 obj <> endobj 292 0 obj <>stream Hڳkߞ )ۍ endstream endobj 293 0 obj <>stream H‰@%(Ekt-Td7y|{۴MӪʪ,"/,R& $ />vs-2m˰yAtA::A~hPۃA՝V7$7/ܒ_2fjAjFͨg endstream endobj 294 0 obj <>stream H‡BP%ٽȊ#Ӹ~>.28N0qavj[PӠn.((yaA& g ѯ^xqcَi2LKMU7TMWn@rxxAx3 wfMOāړ숯٨m endstream endobj 295 0 obj <>stream Hڳ  endstream endobj 296 0 obj <> endobj 297 0 obj <> endobj 298 0 obj <>stream H8oġ %tA endstream endobj 299 0 obj <>stream H[PRdNtO*I\2LƬל+Ѡ2s*BE@$IqB )$5x)-Q%5VUtSZi+V_34\78c/M`.zFx>]z?$yie>stream HR0zڳMa =C;ϓRzPǶ-:/44 ؏C7m7]Wm6eSuW)ˬ,"Or Iei&~=];qC+}O\u(ȖlKL48` /Cʟ"CD[s{c\[ endstream endobj 301 0 obj <>stream Hu ٔA endstream endobj 302 0 obj <> endobj 303 0 obj <> endobj 304 0 obj <>stream Hz3PF_mA endstream endobj 305 0 obj <>stream پؼ׺ָնԳӱѮЬϩ̤ͦʡȞǛŗԑ|xuqmid`[VQLGB<7 endstream endobj 306 0 obj <>stream n0n0n1o2p2p3q4r5s6t8u9w:x> endobj 308 0 obj <> endobj 309 0 obj <>stream Hz]oz(#Lig endstream endobj 310 0 obj <>stream ؿ׽ջԸӶѴбίͬ˩ɧǤšĞ›|xtqmie`\WSNID?:5 endstream endobj 311 0 obj <>stream l.l.m.m/n0o1o2p3q4r5s6u8v9w;x{@|B~DFHJLNQSUXZ]_bdgjlorux{~꫁뭄밇첊쵎 ŤǨʬͱеӹֽ endstream endobj 312 0 obj <> endobj 313 0 obj <> endobj 314 0 obj <>stream HWѓH=F>:B}}x3_z{ǿ=Α}uͽ_nrmǗ+[\/W~>|tڧC?+>/|:w};$sdH endstream endobj 315 0 obj <> endobj 316 0 obj <> endobj 317 0 obj <>stream ܿۻٸ״԰ҬШΤˠɛǗēŽ|wrmhb]WQJD=7 endstream endobj 318 0 obj <>stream 7889:<=>@BDEHJLNPSUXZ]`behjmpsux{~ŽĒƕșʜ̠ΤШҬ԰ִٸۼ endstream endobj 319 0 obj <> endobj 320 0 obj <> endobj 321 0 obj <>stream ܿۼٸ׵ղӮѫϧΣˠɜǘŕÑ~zvsokfb^YTOKFA<7 endstream endobj 322 0 obj <> endobj 323 0 obj <> endobj 324 0 obj <>stream n0n0n0n1n1o1o2p2p3q4q4r5s6t7u9v:w;x=y>{@|B}DFHJMORTWZ\_behlorvy}ŦɫͱжԼ endstream endobj 325 0 obj <> endobj 326 0 obj <> endobj 327 0 obj <>stream Hס endstream endobj 328 0 obj <>stream n0n0n0n0n1n1o1o2p2p3q4r5r5s6t7u8v9w;xz?{A}B~DFHJLNQSUXZ]`behknqtw{~ŤȨ˭ϳҸֽ endstream endobj 329 0 obj <> endobj 330 0 obj <> endobj 331 0 obj <>stream ԾһϷʹ˰ȭƪĦ£㿟⽜⻙ḕඒߴ޲ݯܭ۫ک٦{ؤxעu֠r՝o՛lԙiӗfҕcѓ`Б]ϏZΌW͊T̈Q̆N˄JʂGɀD~A|>z;x9v6u3s1 endstream endobj 332 0 obj <>stream H:\lxx(#Y endstream endobj 333 0 obj <> endobj 334 0 obj <> endobj 335 0 obj <>stream HS}0ҹSJHP2@dx^J{fZޯ`AÃmn;<u< xdb)1O'_*q endstream endobj 336 0 obj <> endobj 337 0 obj <> endobj 338 0 obj <>stream Hd x endstream endobj 339 0 obj <>stream H| @[fq\S4-3 #i!BvjBǠǣX@ag[:j!@+=0HbQXr+:PGP3nb"-[j35&3~F(eJMna̲r|Ż,˪> endstream endobj 340 0 obj <>stream H@nn8<؏}۷u[uyqq臾뻶뚶ۦj겮e00ygqFi&qG~zQ膁kښcXl%CuU^92` IE8gṙ 'E>stream Hs j endstream endobj 342 0 obj <> endobj 343 0 obj <> endobj 344 0 obj <>stream HZmת  endstream endobj 345 0 obj <>stream HTG@;6K^DD@vĮdoQmh$h ڡXKs= 30J/LZRStf%l:Tw=izȏAIYfm}~̋Sq>_|]U'ɘ% endstream endobj 346 0 obj <> endobj 347 0 obj <> endobj 348 0 obj <>stream H Bj@((I$PRv뺪W)wi4y$8 |Ax_owj_\˹l<ۆuMK;TTAUMPT^V8iev'1H;-OlfA( ^A8 `钘Fr8_ "=)Ԟ1` endstream endobj 349 0 obj <>stream ʿɽǼƺŹķö endstream endobj 350 0 obj <>stream Ha ? endstream endobj 351 0 obj <> endobj 352 0 obj <> endobj 353 0 obj <>stream H{^Z*JEJQu\k̡HD:bSԂX$ R daCcW8'@DJhQf$UNxu-h6$Tjn[a̝u\k]9=axFaG-N$MeEYUUu 0' endstream endobj 354 0 obj <>stream ʾɽǻƺŸĶµ endstream endobj 355 0 obj <>stream Hf !| endstream endobj 356 0 obj <> endobj 357 0 obj <> endobj 358 0 obj <>stream H`WwkHJqt=hBQWaQE@-hcU]@' )vDq0! Ɖ8/A&EZVEcU A)-ŜOg혳Swa{Kg,ׁl]wa(>)I|\o,?+-, 7 endstream endobj 359 0 obj <>stream üľ endstream endobj 360 0 obj <>stream H=s(#o endstream endobj 361 0 obj <> endobj 362 0 obj <> endobj 363 0 obj <>stream Hp锡 Tv endstream endobj 364 0 obj <>stream HK @~9L)+D# #Zʭ5z>stream ̿˾ʼɻȹǸƷŵĴò± endstream endobj 366 0 obj <>stream HZk׊ ⮇ endstream endobj 367 0 obj <> endobj 368 0 obj <> endobj 369 0 obj <>stream Hj4@{ih endstream endobj 370 0 obj <>stream HlYRjZְ10flxSz^x} JX(Y&hd $[͕iUVq"K bUJU紆T̖jٺ6=Πz}wp`6m|g+I4M { endstream endobj 371 0 obj <> endobj 372 0 obj <> endobj 373 0 obj <>stream Hڸơ }A endstream endobj 374 0 obj <>stream H ‰B@Z}!3V rGc&@j I@b4bx VXs"%(H(#Q$5V9U5CMѰdV,G] wcz F~ vq}'>=&SeszveYU|uiov]Oл, endstream endobj 375 0 obj <>stream HBPj! 9B9sQvi }um6O4U]UUe^YYi~GIqE~>};vװzhr7!kwQՅ+*'+teD$IN .>stream ȾƽŻù· endstream endobj 377 0 obj <>stream H_(#t endstream endobj 378 0 obj <> endobj 379 0 obj <> endobj 380 0 obj <>stream Hڼm桌 endstream endobj 381 0 obj <>stream H 0˜8/˥ie n O6zp46R5UE PӦZȃwHiH\Nيy?\>stream H ‰D u\*9͚7<8}۶u]ezQZ+YM>stream H:sꙡ  endstream endobj 384 0 obj <> endobj 385 0 obj <> endobj 386 0 obj <>stream Hjmn \Ze endstream endobj 387 0 obj <>stream H 7/K`1;0lW}?oXmmb1)&4F(#;Z798O!tk\˖z=[X'l endstream endobj 388 0 obj <>stream HW0R Q}Ιھ}gv\xk>˕0!a#B{4ZиW6nARYX G2zz G0'݈5g?jJz endstream endobj 389 0 obj <>stream H0yƄ n endstream endobj 390 0 obj <> endobj 391 0 obj <> endobj 392 0 obj <>stream Hz4-PFΔv endstream endobj 393 0 obj <>stream bcdfgijlnpqsuvyz|~謀譂鯄鰆鲈곊굌뷏븑뺓켖켘âŤǧȩʫ̮ͱϴѶӹԼ׿ endstream endobj 394 0 obj <> endobj 395 0 obj <> endobj 396 0 obj <>stream HZl 7a}A endstream endobj 397 0 obj <>stream ǿƾżû¹ endstream endobj 398 0 obj <>stream ľ¼}{yv}t{ry}pw{nuzlsx endstream endobj 399 0 obj <>stream H) RU endstream endobj 400 0 obj <> endobj 401 0 obj <> endobj 402 0 obj <>stream H 0[issҡ%%IT`{A_(sw(d4SXB> endobj 404 0 obj <> endobj 405 0 obj <> endobj 406 0 obj <> endobj 407 0 obj <> endobj 408 0 obj <> endobj 409 0 obj <> endobj 410 0 obj <> endobj 411 0 obj <>stream HZnӢ oЀ endstream endobj 412 0 obj <>stream H|K @__3/ͲD ## r;KhӦc8l{&bnB>%e$L8&MѰ$֌؎,rRz~@pnm'䔦5nG^ϲ|UU]oNԍ endstream endobj 413 0 obj <> endobj 414 0 obj <> endobj 415 0 obj <>stream Hb졌 { endstream endobj 416 0 obj <>stream H| @wu, 0**$<ɣ-13-']z4}Ң< THee:f9lqu0]^dq[/0 8%4;ev(^e0Ɗ# endstream endobj 417 0 obj <> endobj 418 0 obj <> endobj 419 0 obj <>stream HiB7:9sLED$i6?b.q$]aBJ,JpXA$-PH, !/4<UWGk3Mt6̹9[ZcWq~=v=ή{A(8N$M|Y(,+ǖ" endstream endobj 420 0 obj <>stream H ‡BP|<{8:rݡnA!Yd1a) (V9r ërK lH)٪hay[N`E10Nc'$=Ys~ɋTeYWUS7mޮ׮?0>stream Hڱ o endstream endobj 422 0 obj <> endobj 423 0 obj <> endobj 424 0 obj <>stream H @ qqm0SK2! <ɣA?Mo4y Se!*TR24dȄB!L7]^Y0muqM8%Y?fS碼UU]4}tϮ0`l$ endstream endobj 425 0 obj <>stream HChbarݶm.24M۶k˲*2ϋoi$8N( 8"=/p]xZkZtttK}fT]Vޒ*<^|q2I$1C !xwwtC;c endstream endobj 426 0 obj <> endobj 427 0 obj <> endobj 428 0 obj <>stream HtY @_) S453}_fQzek^i=M[F!83aP AC {;Z7}Wwm6ESuUeRqyd&^Q䄁M7Ql[eQ^Teț`* endstream endobj 429 0 obj <> endobj 430 0 obj <> endobj 431 0 obj <>stream HZzu(#^[A endstream endobj 432 0 obj <>stream s%t%u&v'w(x)y*z,{-|/}0~23ـ5ق7ڃ8ڄ:څ<ۆ>ۈ@ۉB܊D܋FݍHݎJݏLޑNޒPߔSߕUߗWY[^`bdfikmoqtvxz}鵁鷄긆꺉뼋뾎ÖŘǛɞˠͣϦ endstream endobj 433 0 obj <> endobj 434 0 obj <> endobj 435 0 obj <>stream H\i70֚+-kJZRRj.|^]{_UUeYeygYi$qGQ#x~{zmDzlӴ uCtU)*WI,g?qG={݊ڐKXP|$:%F` c 쀍`i endstream endobj 436 0 obj <>stream lsxlsxltxltxltxltxmtymuynuynvzovzow{pw{qx|qy}ry~sz~t{u|v}x~yz{}~ endstream endobj 437 0 obj <> endobj 438 0 obj <> endobj 439 0 obj <>stream HOH =HA endstream endobj 440 0 obj <>stream _`babdbcfefhfhjijlklomnpopsqsutuxvwzxz|z||~~ endstream endobj 441 0 obj <>stream ľ¼~|~z{~wy|vwztuxqsu endstream endobj 442 0 obj <> endobj 443 0 obj <> endobj 444 0 obj <>stream H j>stream OPRQRTTTVVWYXY[[\^]^``acbcfefhghkjkmmnpopsqsutuxvwzy{}{}} endstream endobj 446 0 obj <>stream ľ¼}{}y{}wy|uwy endstream endobj 447 0 obj <>stream H*-, OYA endstream endobj 448 0 obj <> endobj 449 0 obj <> endobj 450 0 obj <>stream HЪa(#yze endstream endobj 451 0 obj <>stream Ht½ ahVf3L,7HI$E@R"uu{ﯟ0{z_z.;2W$TEPN:c75\ A<tۣod$:i!N7pi[I0kqըQŰiLP  endstream endobj 452 0 obj <>stream //0012345689:<>@BCFIJMPRUX[^adgjmpsvz}ËŏǓʘ̜ΠФөծײٷܼ endstream endobj 453 0 obj <> endobj 454 0 obj <> endobj 455 0 obj <>stream Hzn(#e` endstream endobj 456 0 obj <>stream H/??Ao}_?ōϮyrϣss;ڮ?ٵ?Oy|#scϤ;z~liꪯK.2/ˬOS"?MCjwZ [ endstream endobj 457 0 obj <>stream o#o#o#p#q$q$q%r&s&t(t)v*w,x-y/z0|2}4~68:=?BEHJMQTWZ^aehlosvz~Ğǣʨήҳչؾ endstream endobj 458 0 obj <> endobj 459 0 obj <> endobj 460 0 obj <>stream HRe(#@bA endstream endobj 461 0 obj <>stream t!t!t!t!t!t!t"u"v#v#w$w%x&y'z(z*|+}-}.02468:=?BEHKNRUY\_cgkosw{ÙƞɤͪѰնٽ endstream endobj 462 0 obj <>stream r!r!r!s!s"t"t#u$v%w&w'x(z*z,|-}/~1357:<>ADGJMQSVZ^aehlosvz~™Şɣ̩Ϯҳֹڿ endstream endobj 463 0 obj <>stream H\y(#a endstream endobj 464 0 obj <> endobj 465 0 obj <> endobj 466 0 obj <>stream HRee(#7g endstream endobj 467 0 obj <>stream z0{2|3}589<>@CFIKNQSVY[^bdgilorux{}›ŞƢɥ˩έаҴո׻ٿ endstream endobj 468 0 obj <>stream HBo~ ~~ۻ_?=͝nqK;7vŵ-{zg_]XkMe?} ߺLh}U0z endstream endobj 469 0 obj <>stream HRe(#dA endstream endobj 470 0 obj <> endobj 471 0 obj <> endobj 472 0 obj <>stream Hz @ B" R{WDJޕi+y_R}j&>ԛhdcv׏]{?}iR)~en_~]ZuEٷ57c{=ȼ':MsП<՝pyi endstream endobj 473 0 obj <>stream o#p#q$q%r&t(u)v*w-y/z1|3}57:> endobj 475 0 obj <> endobj 476 0 obj <>stream Hڤu(#e endstream endobj 477 0 obj <>stream HTG0($TD P{:r7$\٨Y/MvlpwA`Wђ/V܌cjpVVІ-V,) CxVSV d'hרҾJ{Y`=` endstream endobj 478 0 obj <> endobj 479 0 obj <> endobj 480 0 obj <>stream r!s"t#v%w'y)z+|-}1358:>@CGJLPSVZ]`cfilpsvz}ÚŝȢʥͪϭҲԵֺپ endstream endobj 481 0 obj <>stream پֺԷҳаά˨ɥơŝ™}zvsplieb^ZWSOKGD@<95}1z-x*u'r$p! endstream endobj 482 0 obj <> endobj 483 0 obj <> endobj 484 0 obj <>stream H:W|n(#qXA endstream endobj 485 0 obj <>stream p#p$q$r%s&t'u)v*w+x-y.z0{1|3}56Ӏ8Ӂ:ӂ<ԃ>Ԅ@ԆAՇCՈF֊H֋J֌L׎N׏PؐRؒTؓVٕYٖ[ژ]ڙ_ۛaۜc۞eܟgܡjݢlݤnޥpާrߩtߪwy{}᱀Ⳃⴅ㶇三乌廎彑濔™Ĝƞȡ endstream endobj 486 0 obj <> endobj 487 0 obj <> endobj 488 0 obj <>stream H BQ endstream endobj 489 0 obj <>stream klolmpmnpmoqnprpqtqrurtvstwtvxvwzwx{xz|z{~{}}~} endstream endobj 490 0 obj <>stream Hv浡 D endstream endobj 491 0 obj <> endobj 492 0 obj <> endobj 493 0 obj <>stream H…0YJ %Hjh _aʛ)/<უ;G7xQ哣U[WxW>^D~*r@Fd =؍Nda+2L1Ǵ&'4KjbU`9J]LH^ endstream endobj 494 0 obj <> endobj 495 0 obj <> endobj 496 0 obj <>stream H8PFIm endstream endobj 497 0 obj <>stream H4‰@ .( *?ȏw@ b5QXz3\(W5oI/i8c>}:t a]*e endstream endobj 498 0 obj <>stream H$ B`#Q4 % sύmm:`"}tK9b rE^O7evSno~wѽa21&fx endstream endobj 499 0 obj <> endobj 500 0 obj <> endobj 501 0 obj <>stream H\y(#Ka endstream endobj 502 0 obj <>stream H…0YlքYBX?[^쓳7GF=7%g<%q}bM$:+\"M3ǁQV oU5m[ `˱\ endstream endobj 503 0 obj <>stream H\ @uzZ*nAabE =w dI%˚,V{X0rcz~Zha8\šzShFFY] P>ɹB.Ur[-Gg^r endstream endobj 504 0 obj <>stream H8PFbmA endstream endobj 505 0 obj <> endobj 506 0 obj <> endobj 507 0 obj <>stream H_"*q$n 3#-iy%%.\>>8wOb6:<&g&Q92141FdGG[NͰl&UTRIE  0d& endstream endobj 508 0 obj <>stream HT0Љ.ZP=p4h/I1_bm}W]]tɧSCgfd5Yhxu7VB{%< x"w >stream Hzv(#M<_ endstream endobj 510 0 obj <> endobj 511 0 obj <> endobj 512 0 obj <>stream Hzd(#m^A endstream endobj 513 0 obj <>stream H VPݼyX!JJE ͓8=wڡ?/]~> ޢ75fU`1K|.s=wnkW'G.cOs]mEjNI Nc*GT `X endstream endobj 514 0 obj <>stream HT ak1fqg{ƾKHr䏧'H&_/DE.["Ln%,$k$$$$[mDggg{ {{ {kkk ss憍-;6X?~bڅ+7Vp+/_ym+W endstream endobj 515 0 obj <> endobj 516 0 obj <> endobj 517 0 obj <>stream H:Usj(#[ endstream endobj 518 0 obj <>stream H\` u<=D-n^F71>stream H\… @q}B;`/ э?ʼ4OT|`6\19c,'1!֕Di endstream endobj 520 0 obj <>stream Hzlp(#qze endstream endobj 521 0 obj <> endobj 522 0 obj <> endobj 523 0 obj <>stream HЪa(#f endstream endobj 524 0 obj <>stream ܾڻطִԱҭЩΦ̢ʟțƗĔ‘{xtqmjfb^ZVRNIFB=951-)% endstream endobj 525 0 obj <>stream o#p#p$q%r%s&t(u*w+x-z/{1|3~57:=?AEGJMQSVZ]`cgjmptw{~ĞǢɧ̫ϰӵֺؾ endstream endobj 526 0 obj <> endobj 527 0 obj <> endobj 528 0 obj <>stream Hz_~(#Wkb endstream endobj 529 0 obj <>stream ۿټָյҲЮΪ˦ʣǟŜØ~{wtpliea^YUQMIEA=841-~){%y" endstream endobj 530 0 obj <>stream !"#$$&')+./2469;>ADGJMPSVZ]`dgjnqtx{đŕșʝ͡ϦѪӮֳٸۼ endstream endobj 531 0 obj <> endobj 532 0 obj <> endobj 533 0 obj <>stream Hzr(#zpA endstream endobj 534 0 obj <>stream HzuÑ?Po  z B!C_M{51ĈW"_Oz=%ԘSL3=̤3J};'܌w-y0ݢK /-Ê>OZ>onuof~?<?N,qjk~]?vߝC]W endstream endobj 535 0 obj <>stream Hm `>E)I)e٬aH$II/99˞oꢅF͑vv^]THNܲJWUױn h"h!4ic>8ӘL:\>stream HPF} endstream endobj 537 0 obj <> endobj 538 0 obj <> endobj 539 0 obj <>stream Hzb(#^ endstream endobj 540 0 obj <>stream Hz?ʇ#5*P}Q$^:iPW@TLUrW _W1y]cuF7MvoZ޶9mw{]>L0=ďs>(Ң/+˿;{Ь= km endstream endobj 541 0 obj <>stream ̩˨˧ʦɥɤȢǡƠşŞĜڙ~}{yxvtsqonlkihfdb`_][YXUTRPNLJHF endstream endobj 542 0 obj <>stream Hm(#%q endstream endobj 543 0 obj <> endobj 544 0 obj <> endobj 545 0 obj <>stream Hzb(#oA endstream endobj 546 0 obj <>stream Hz @F/{_Q_M|5)Wc^O}3-73L~3+휴s2|;?w-.|ò+?ں>ml/{g}SG8ǩήua[\w"K endstream endobj 547 0 obj <>stream Hk P_6!$ԒR㰙YN,$I~{9"==`i};ϓY]|@HaY%p˸g⺊~ :n4qBF١]= tѢӐ|u7?= [80] endstream endobj 548 0 obj <>stream HPF} endstream endobj 549 0 obj <> endobj 550 0 obj <> endobj 551 0 obj <>stream Hښmu(#V endstream endobj 552 0 obj <>stream HښmYó\ݖgB`䰭q[:o/r^ DnKܷz(QggJ]w ]!|wc=-{Z%Hۙ+m_o&\tpjgT]{hn͇Yudi|lcfMd endstream endobj 553 0 obj <>stream Hk `?|>E$KR6wfZ$}?Fo3g[H+(C%+PU5ut6V]=n qo0f>stream H:ܙrx(#l endstream endobj 555 0 obj <> endobj 556 0 obj <> endobj 557 0 obj <>stream H:Vvl(#a endstream endobj 558 0 obj <>stream H:Vv r?V A@tjzP:~O4h <t)DsɖГa'OG:s+TwܩӽIOOH=31̤3SL=;=s.=7 k/²֋+:.꾸Һ6Nysle{_ݿup_ endstream endobj 559 0 obj <>stream Hm P}h$%ٙј&"Iq|>dQY/˿ַͪ̚j l"laF؆v{ "0F6qӌ9/>ogWw`}D endstream endobj 560 0 obj <>stream H> endobj 562 0 obj <> endobj 563 0 obj <>stream HXq(#a endstream endobj 564 0 obj <>stream u u u u u!u!u!v"v"w"w#w$x%y%z'z(|*|+}-/02468;=@CEILOSVZ^beimquz}—ŜȢ̨Ϯӵټ endstream endobj 565 0 obj <> endobj 566 0 obj <> endobj 567 0 obj <>stream Hz5#PFCu endstream endobj 568 0 obj <>stream Hz5# ~5B@hV( zN9Db^Ϗ{3?͂7 ,Lz(ԷK.|,w+r߯,xkJ?+ƚ>niO;:?˾_Ozhóo8ǹ?/nyyۯk?NypߓK> endstream endobj 569 0 obj <>stream H[ `_|ZHQRZ))ه9LCC$%~{ƥ!w|gO; "B,rq\I%ѭJ^uZ6hݤN~vmwh@WOV򾕏|// endstream endobj 570 0 obj <> endobj 571 0 obj <> endobj 572 0 obj <>stream HVnm(#m[ endstream endobj 573 0 obj <>stream HVn 9 mN@\Wюj;=vxY罳gg w5j5|w[{:ctNӓ/uo_ &foJiEQ~`V95thaŝYdŤ]36,>stream H Au\g"$%ak:ٴI41˂o1w-"[6b6dұ75xux &T 6.>!.G03)^Up"8]#_1' 0ro endstream endobj 575 0 obj <> endobj 576 0 obj <> endobj 577 0 obj <>stream H:}|(#f endstream endobj 578 0 obj <>stream H:}@ @F':@+DWЉ!'{BO ?q/Tԩ ѧ&ĞwjR©ɉ$rzZgfd}fV9gW|vAٹU[R{~iMW^XqaMu}Oqʥ/m}i;]޽ޕWrh#[u>Zue endstream endobj 579 0 obj <>stream H[ p|&"IlL&Z~_puA[Ke+궪5ը)f V.>pG8q> endobj 581 0 obj <> endobj 582 0 obj <>stream Hz8PF~xA endstream endobj 583 0 obj <>stream RRRRSSSTTUVVWXYZ[]]_`aceghjlnprtwy{~ŒďƓǖʚ̞΢ЦҪԮֲٶۻ endstream endobj 584 0 obj <>stream H `oYD$RɏVBivP;8p.;{z`'aOEx:jd8IpL , E%eUp^E :.jҺE6:tұGN_˫%oB67ˁ^VJk endstream endobj 585 0 obj <> endobj 586 0 obj <> endobj 587 0 obj <>stream Hz(PF5w endstream endobj 588 0 obj <>stream QQQQRRRSSTUUVWXYZ[\^_acdfgikmorsvx{}ŒÏŒǖə˝͡ϥѨӭֱضۻݿ endstream endobj 589 0 obj <>stream HK Q_IR2Ƙ!H(,eB{7e냖7 ?5 E=z$)쥱Ah*&e6y-jlUg4N{ ~2=p .6{ADo\U endstream endobj 590 0 obj <> endobj 591 0 obj <> endobj 592 0 obj <>stream Hz1PF endstream endobj 593 0 obj <>stream oooooooppqqrrstuuvwxy{|}ŒÎĐƓǕȗɚ˜̟΢ΤЧҫԮհ״ٸۻܿ endstream endobj 594 0 obj <>stream H] pu^C"IIIg,#o-B-)JBswBo;cqA%P) f`d1aǸI VV*kӪA&-ڴi^`%lݕY<=y 0 endstream endobj 595 0 obj <>stream Hg ?YA endstream endobj 596 0 obj <> endobj 597 0 obj <> endobj 598 0 obj <>stream Hyc(#[A endstream endobj 599 0 obj <>stream Hy'ҺHnQ>,йY{PVޭb*1]f|vJ;Uwjޭt^v~=hriIOf?lA%/W\jC}ovM}K?Z/|{< =q. endstream endobj 600 0 obj <>stream ܿڼٹֵԲӯЫϨͤˡɝǚŗ“|yvsokhea^ZVSOKGD?;841- endstream endobj 601 0 obj <>stream H֦m(#BxjA endstream endobj 602 0 obj <> endobj 603 0 obj <> endobj 604 0 obj <>stream Hz1PF endstream endobj 605 0 obj <>stream HT Q?%DD$%)<&DD,5]f4 *W r?) }y{id&X2ÒbCU;9P͉.p]?p/H!2aq>s7KH OSª(+¶.2qC8NǙI.O((KA endstream endobj 606 0 obj <>stream HY ak_#$EJIa6LYDɔs4ΕGi!Ng 1a$ff VVvy p0*c\if5i٠U۴hgç _|uAn?Go雂 endstream endobj 607 0 obj <> endobj 608 0 obj <> endobj 609 0 obj <>stream HXq(#KcA endstream endobj 610 0 obj <>stream v&v'v'w'x(y)y)y*z*{+{,|-}-~.~/011233466789::<=>??ABCDEFGHIKLMNOPQSTUVWXZ[\^_`ab endstream endobj 611 0 obj <>stream H] `3 $I))8pޱ ۴D<˩1kW'IuȐUEDD!f%uSfVuvm6x]=8p>stream HZ(T RF_56i}mڢE[6oFMu~m[~]O>4Ӄ 1'Ǽ S~.<窢_k+~m{&90N{n; r endstream endobj 613 0 obj <>stream HZu(#bZeA endstream endobj 614 0 obj <> endobj 615 0 obj <> endobj 616 0 obj <>stream HPa(#c endstream endobj 617 0 obj <>stream u'u'u'v(w(x(x)x*y+z+{,{-|.}.}/~001233456789:;;<=?@@ABDEEFGIJKLNNOQRSTVWWYZ[]^_aa endstream endobj 618 0 obj <>stream HK AA~ $Rr̉KB(7Mi&kw;lO%#i–I)iː,yTU_U ɛoۼˇ><ː#5<}o$ endstream endobj 619 0 obj <>stream HZHTG`E @Ak#mڤYkoz }k7i[}vOt>1+ǜ.L$ܟ~;:?G9﹍/0 r{ endstream endobj 620 0 obj <> endobj 621 0 obj <> endobj 622 0 obj <>stream HPa(#>bA endstream endobj 623 0 obj <>stream t%t%u%u&v&v&w'x(x(y)z*{+{+|+},~-~-.011234456789:;<<>?@@ACDEFGHIJLMNPPQSTUWXYZ[\^_ endstream endobj 624 0 obj <>stream H*Q(NDEIV'Qʯ5 6 2~YІo,[Jo)k?{?'9<ϑsb៓K^ڿ7 = endstream endobj 625 0 obj <>stream HR0RZN Hk 5~mPڨQkf-:_[k3n[no=;}})ߧcV䏹?$\siVZ_ksmw7/sfߋ Zqp endstream endobj 626 0 obj <>stream HRe(#d endstream endobj 627 0 obj <> endobj 628 0 obj <> endobj 629 0 obj <>stream Hzڨt(#+Zd endstream endobj 630 0 obj <>stream Hzڨ=m"}02g͆Ϛ?k5#gm͟wX>ziy݋=/z_jIޯ&zj!offv۹qo%[nQfXae%זPycݗ-_|uwϷ}:יeίsi߫ "w endstream endobj 631 0 obj <>stream H17(>stream H17PFP endstream endobj 633 0 obj <> endobj 634 0 obj <> endobj 635 0 obj <>stream H\yy(##\ endstream endobj 636 0 obj <>stream H\y@ΕJ+Uz`J+5WkM֙^7ZoqZ&kMvZ:]ouzF.ݾzn=1SbL3=Ό仳ͼ7?ނ,)}Gmz'[lt״{f=?/0S(n endstream endobj 637 0 obj <>stream Hz<11 (&!D49 $Q MM}<- ?dF擙YOff?dv9yO>stream Hz<1PF&t endstream endobj 639 0 obj <> endobj 640 0 obj <> endobj 641 0 obj <>stream H^{}(#E<_ endstream endobj 642 0 obj <>stream {-{-{-{-{-|-|.|.|.|/}/}0}0~1~233ـ4ـ5ف6ف8ق9ك:ڄ<ڄ=څ?چ@ۇBۈDۉEۊG܋I܌K܎MݏPݐRޒTޓVޔYߖ[ߗ^`cehknqtwz}宀射沈测総纓輘鿜ĥǩʮ endstream endobj 643 0 obj <>stream H Au>-!$%R nHRʍ||sv[C_#f;j1SI$hL(e$3$-d1a[E 2lՕP:ԱN>w7wW?W#8~ endstream endobj 644 0 obj <>stream Hz>5PFHCw endstream endobj 645 0 obj <> endobj 646 0 obj <> endobj 647 0 obj <>stream H]{{(#aA endstream endobj 648 0 obj <>stream H]{ѝ: z02`tN] j2d~n{6lpt~ۃ=pRУ!?xFqOf'>d^Oe?[li%WXSr] 6z{f̷;eOpf@sh endstream endobj 649 0 obj <>stream Hz==5hF*z&, ٙ 4'7ss@h^yoYPfaћEoYRfieoWT]Yvu5 o5ncǻ]>ݮLoY'W8 ހ endstream endobj 650 0 obj <>stream Hz==PFy endstream endobj 651 0 obj <> endobj 652 0 obj <> endobj 653 0 obj <>stream Hz>PFoA endstream endobj 654 0 obj <>stream FFFFGGGHIIIJKLMNOQRSUVXZ[^_bdfhkmorux{~ﳁ—ěǟɣ̨ϬѲշ׻ endstream endobj 655 0 obj <> endobj 656 0 obj <> endobj 657 0 obj <>stream H:Teuh(#c] endstream endobj 658 0 obj <>stream z:z:z;z;z;z;z;z<{<{={=|>|?|@}A~B~CDEÀFÁGĂIĂJăLĄNąOņQŇSʼnUŊWƋYƌ[Ǝ]Ə_ǐbǒdǓfȕiȗkșnɚqɜtʞwʠzˢ}ˤ˦̩̫ͭͯβδϷϺмѿ´ŹȾ endstream endobj 659 0 obj <>stream Hzա  endstream endobj 660 0 obj <> endobj 661 0 obj <> endobj 662 0 obj <>stream Hq{(#~\ endstream endobj 663 0 obj <>stream Hq'DFwHN>6-ҽ[wXnRûeFMUޫ2_mq~zN]?j~;I_ӉO'=|V/\Rje뵍o6~~<鵟/nz~<ÿ_ Rq endstream endobj 664 0 obj <>stream ؾ׻չӶҴбήͬ˩ɦǣšĞ›}{yuspnlhfca^[ endstream endobj 665 0 obj <>stream H>-PF'rz endstream endobj 666 0 obj <> endobj 667 0 obj <> endobj 668 0 obj <>stream Hz3;PFR{ endstream endobj 669 0 obj <>stream Hz3; 42AhneCѼs{ -*|ݒwKK+*߯zk>oƶ[:?nΉvOwƗ袯'= /l~y~:_zz>`z endstream endobj 670 0 obj <> endobj 671 0 obj <> endobj 672 0 obj <>stream H>E;N$D?B<)@4Ӕ~LW?fcY?fsy?osEv?;Zk>VZ{m 7%ޒg{ΟW`ߣO;=./wmտ[/s?@.~ endstream endobj 673 0 obj <> endobj 674 0 obj <> endobj 675 0 obj <>stream Hqw(#M\ endstream endobj 676 0 obj <>stream Hqʃ M{`T}P^b һ_bp~ T[> endobj 678 0 obj <> endobj 679 0 obj <>stream H\'R\?Q })QR D_Կk~RJKޗ/F_M6}ml[NozO>9Ԉ3b~N1/碬K,Ɔ[#s\ܺW}߃S_o`͢v endstream endobj 680 0 obj <> endobj 681 0 obj <> endobj 682 0 obj <> endobj 683 0 obj <> endobj 684 0 obj <>stream H[ `_<&$J)BP.O;f̡{;jw蔊O'f(@EDYA֡P&T݆@wqӛ2?o:m`` [v |? EPqM endstream endobj 685 0 obj <>stream H,W0b¼qoœ1܌Ͻ7qOѼ=+7'r{--Io8 C]Nj.|` endstream endobj 686 0 obj <> endobj 687 0 obj <> endobj 688 0 obj <>stream HRe(#q b endstream endobj 689 0 obj <>stream HR * %T B* T F_տh|RNkz_6|m1j[ͷ.oNz]{|}Aߧcvy?\sYϕſ֔Z_ksw?YN,{f%@SopS endstream endobj 690 0 obj <>stream ̨̩˨ʧʦɥɤȣȢǡƠşŞĝۚ~}|{yxwvtsqpomlkihfedba_^][ endstream endobj 691 0 obj <> endobj 692 0 obj <> endobj 693 0 obj <>stream H-m(#lh endstream endobj 694 0 obj <>stream H- ?  ޫCJ{)Wޯ_O>IdS L51t3̲1\=~.8_#~:׺oΪ?{h{O{~+]v?> `W| endstream endobj 695 0 obj <> endobj 696 0 obj <> endobj 697 0 obj <>stream Hzt(#^A endstream endobj 698 0 obj <>stream Hzʇ#u*"g`T BJHY2+ W>2~^eE:/m_6ٿlqzuכn7oN {;%ݴw3I0?܏K ?-/Zm義?}|3+ 0mM endstream endobj 699 0 obj <>stream '()+-013569;> endobj 701 0 obj <> endobj 702 0 obj <>stream Hz`(#OZ endstream endobj 703 0 obj <>stream Hz?"%zD@ B9@0T=W@Q֣"GźK<.7z\iI: O>k|;E_ˉQ/Ľzvƛo]^nMm~3y_/zn+>߯,Yo endstream endobj 704 0 obj <> endobj 705 0 obj <> endobj 706 0 obj <>stream H%m(#Tg endstream endobj 707 0 obj <>stream H% R#o`ԣG{/|UޫO{~:'}}I'|b}ŏiV?ncÏY?fcy?\saő?\kEүVeZk] E7\{kmw6go}NsxڟX䒿gVZx endstream endobj 708 0 obj <>stream HzHG E H HQb y\Tq2O*T>6{Zcig͎[_|7UoDvVʻ}XZqEŧ7|}ğf:HjZ endstream endobj 709 0 obj <>stream Hzp(#W]A endstream endobj 710 0 obj <> endobj 711 0 obj <> endobj 712 0 obj <>stream Hz,v(#kc endstream endobj 713 0 obj <>stream Hz,ɃP )@QV%jS~צ]]ڻw:w}߭}^}f->L0$?Nq8tO3?4;Ӝ>Ϗ0ˢ/K,M<ʜ-klm箎{z~߇g>6O0u0 endstream endobj 714 0 obj <>stream HzZxTB2 yZ\YU?4xVeyZu-^4XhyleW]_fR)oǾ~nڇY\ViUuu_7|}ğf:l endstream endobj 715 0 obj <>stream HzZt(#b` endstream endobj 716 0 obj <> endobj 717 0 obj <> endobj 718 0 obj <>stream H*{k(#`W endstream endobj 719 0 obj <>stream H*{ 6< ;w2HNl9*wsTSq@~"zJ>,7zXaQu6O4:>stream HzݠjDFzA Mi1yjmvo;vZym]ӻ>n'xaqV9'|^yqƗe9_W|]]m}M?6ko`p endstream endobj 721 0 obj <>stream Hzݠz(#zf endstream endobj 722 0 obj <> endobj 723 0 obj <> endobj 724 0 obj <>stream H*uo(#|_A endstream endobj 725 0 obj <>stream ޅޅޅޅކކކކކ߆߇߇߇߈߈ !"$%&(*+-/12579;>@CEHKNQTW[^adhkorvz}ÎƓɘ̝ϢҨխٳ endstream endobj 726 0 obj <>stream HzR@(4@ 5AH k?)yRTIrOV>1{Vgyf/]^vzjBaoEvN~XQqM_5f:ϥUnn05>k endstream endobj 727 0 obj <>stream Hzh(#Xm]A endstream endobj 728 0 obj <> endobj 729 0 obj <> endobj 730 0 obj <>stream HW!so(#\ endstream endobj 731 0 obj <>stream ѫѪЪЩϨΧΥ̢ͤˡʟɞǜƚŘĖÕ~{ywurpnkigda_\ZWTQNKHEB?<9630-*'}$|!zx endstream endobj 732 0 obj <>stream HzBGPA @Qi?*yTTqrFO*MT=xZgYV/_zJo禾[aY575~_' [gw endstream endobj 733 0 obj <> endobj 734 0 obj <> endobj 735 0 obj <> endobj 736 0 obj <> endobj 737 0 obj <>stream H\R\AT>|)"/j_Jտ)RB:_tT1RkkFV_[lp[׷~O>-~K0璼ˋ~.צoó_Jlo endstream endobj 738 0 obj <> endobj 739 0 obj <> endobj 740 0 obj <>stream Hzz(#m] endstream endobj 741 0 obj <>stream HzB<0W!* UMڛb%oKޖ o V1~[k]FM[߷:osC^'|iJԧ鱟f&|enڗY_~]RmyɷUV__}c?w=׾)stY `q endstream endobj 742 0 obj <>stream H1h*1̀(l 1'ǜs~ 1/ȟ.0.I4˳~*ך_J~/צ[~ok??9~ endstream endobj 743 0 obj <>stream H1PFv endstream endobj 744 0 obj <> endobj 745 0 obj <> endobj 746 0 obj <>stream l l l l l m m!n!n!o"o"o#p$q$q%r&s't(u*v+w-x.y0z1{3}5~79<>@CFILNQUX\_bfjmquz~›Šɦάҳոٿ endstream endobj 747 0 obj <>stream H>-;( łt `43̄3J?cnڏy?gXcaE?\ZsY?W\]kmͯu66{[ݿwOwʟ?=Mwk{G=:9 endstream endobj 748 0 obj <> endobj 749 0 obj <> endobj 750 0 obj <>stream HXyCQ~>O >1CO>%Ԉ"O>#̸~N17 2~.8ˋ~,_mn߻~?G9{ endstream endobj 751 0 obj <>stream Hm(#or endstream endobj 752 0 obj <> endobj 753 0 obj <> endobj 754 0 obj <>stream H\'RB4UKR RR\KU|Rmkzӯ _,|m[Ƿ^O>5M0ܟˋ~.;:s`ڟZºWuÓ_0W s- endstream endobj 755 0 obj <>stream ڿٽ׻ֹշԵҳҲаϮ̩ͫ˨ɦȣǡşĝÛ~|zxvtrpnljhfdb_^[ endstream endobj 756 0 obj <> endobj 757 0 obj <> endobj 758 0 obj <>stream Hڒ#e(#dL endstream endobj 759 0 obj <>stream Hڒ#'\0$5OD %vI(Y,DnW2=*{+TUi_{N`F#Zm۟t>~D/L<+ܤ 3n.ͽok{iojŧ^ޱϯb endstream endobj 760 0 obj <>stream ׽ֻչԷҵѳбί̭̫ʩɨȥƣġß}zyvurpoljifdb`^[ZW endstream endobj 761 0 obj <>stream Hzf(#t endstream endobj 762 0 obj <> endobj 763 0 obj <> endobj 764 0 obj <> endobj 765 0 obj <> endobj 766 0 obj <>stream H\R\?Q })QR Dj_Jտ)RBK*/5_j m0hkVo:]u>SBO13ǜ~.ʒ_k~m?&9<ωϮ{i#@or endstream endobj 767 0 obj <>stream H{iߡ gD endstream endobj 768 0 obj <> endobj 769 0 obj <> endobj 770 0 obj <>stream Hڒ#+ Aж]{Z\:̯6Z^obn˃vG^O| y`LCV endstream endobj 771 0 obj <> endobj 772 0 obj <> endobj 773 0 obj <>stream H:'uz(#"P endstream endobj 774 0 obj <>stream H:'u($ FRgQ M#ٳ t.I\<OQ R.)_LWr9Srڕl+9Wsi_ӹwfۥwVXޫ~PcQF'-ڼ_t |? >Y3 endstream endobj 775 0 obj <> endobj 776 0 obj <> endobj 777 0 obj <>stream Hzj(#_A endstream endobj 778 0 obj <>stream Hz 'REA@HUƫWZK_.}]Mћ7fo-4Xi}]ۻ.w=O y?%ô3>M ӒO>o;'8n}gW}t endstream endobj 779 0 obj <>stream нͺ˶ɴƱĭª忧佤㺠⸝ᵚ᳗߱ޮݬܩۧڤ٢ؠ~؝{כx֙uՖsԔpґmяkэhЋeψbΆ_΄\́YV}SzPxNvKtHqEoC endstream endobj 780 0 obj <>stream H:|t(#z-] endstream endobj 781 0 obj <> endobj 782 0 obj <> endobj 783 0 obj <>stream Hz)t(#>bA endstream endobj 784 0 obj <>stream Hz)@$ Q<)<!EjWzخToSBw[5HNnѽբwEffÛF77\k2hvj ֗m.^Pp\Z5.gj\OU*U^Yzb endstream endobj 785 0 obj <> endobj 786 0 obj <> endobj 787 0 obj <>stream H"{s(#V endstream endobj 788 0 obj <>stream dddddeeffgg g h!i!i"j#k$l%m&m(o)p+q,s.s0u1v3x5y8{:|<?BEHJMQTX[^beimquy}﯂ﲇţɩίҵ׽ endstream endobj 789 0 obj <> endobj 790 0 obj <> endobj 791 0 obj <>stream  !"#$&()+-/1357:> endobj 793 0 obj <> endobj 794 0 obj <>stream H>PF 6o endstream endobj 795 0 obj <>stream 12468;> endobj 797 0 obj <> endobj 798 0 obj <>stream Hzԡh(#e endstream endobj 799 0 obj <>stream -.02357:<>ACFHKNPSVX[^acfhknpsvy|~紁組緇繋纎缑轔迗ÞġƤȧʫˮͲϵиӽ endstream endobj 800 0 obj <>stream Hzˡ ϯ endstream endobj 801 0 obj <> endobj 802 0 obj <> endobj 803 0 obj <>stream  !#$')+.0358;>ACGILPRVY\_cehkoqtwz}ÊčƐȔʗ̛͞ТҦөլװٴ۸ݼ endstream endobj 804 0 obj <>stream H ^A endstream endobj 805 0 obj <> endobj 806 0 obj <> endobj 807 0 obj <>stream Hާ}(#Ii endstream endobj 808 0 obj <>stream !#$&'*,/1469;>ADGJMPSVY\_cehloqtw{~‡ÊōǑȔ˗̛ΞСҥԩ֭رڴ۸޼߿ endstream endobj 809 0 obj <>stream H ܶ endstream endobj 810 0 obj <> endobj 811 0 obj <> endobj 812 0 obj <>stream Hz "% zG@ B9@0T>S{@QBEڏu=.3xRnIj󧵖l5=or|EnA&fZۙo礿[~Ie|ekǷ]?Lyt^`[i endstream endobj 813 0 obj <>stream H{qߡ 7D endstream endobj 814 0 obj <> endobj 815 0 obj <> endobj 816 0 obj <>stream HRke(# h endstream endobj 817 0 obj <>stream HRk:07` Ϳ6YPۯ쿵;~p[^o~'|}rߧGcv⏹)?\sIE?WZSk}{w}?'= l{c;=8/o?@lW endstream endobj 818 0 obj <> endobj 819 0 obj <> endobj 820 0 obj <>stream HRce(#h h endstream endobj 821 0 obj <>stream |0|0|0|0|0|1}1}1}2}3}3~3456689:<=>@BDFHJMORTXZ]`cgjnqtx|Şȣ̩аӶ׼ endstream endobj 822 0 obj <> endobj 823 0 obj <> endobj 824 0 obj <>stream H>=PFP endstream endobj 825 0 obj <>stream Hd `7v[I4fƴaKBKKJRJ]tޟM߷B>9 rP !(a'F8TPMB5i4 -F9Ѹ&Ed UU:Yd%HVOuz2d]f{د`Ɗ endstream endobj 826 0 obj <>stream q#q#r$s$t%u&u'w)x*x,z-z/|0}3~468:=?ACEHJMPSUW[]_cehjmpsvy{~œŠǣɧ˫ίвӷպ׾ endstream endobj 827 0 obj <>stream H\y(#a endstream endobj 828 0 obj <> endobj 829 0 obj <> endobj 830 0 obj <>stream HPF-z endstream endobj 831 0 obj <>stream ԾԽӻӺҸѶдгϱίέ̨ͫͪ˦ˤʢɟȞǛǙƘƖœđύ~|zxvsqomjgec`^[XURPMJFD endstream endobj 832 0 obj <>stream H{ߡ B endstream endobj 833 0 obj <> endobj 834 0 obj <> endobj 835 0 obj <>stream HRje(#f endstream endobj 836 0 obj <>stream uuuttttssrqqponnmlkjjihgfedcb`__]\[YYWVTSRPONLKIHFECB@>>~<}:|9{7y6x4v3u2 endstream endobj 837 0 obj <> endobj 838 0 obj <> endobj 839 0 obj <>stream 00001122344567889:<=>?@ACDFGHJKMOPRTUWY[\^`bdfgikmoqsuwy{}ÃąƈNJ endstream endobj 840 0 obj <>stream 000112234556789:;<=?@ABDEGHIKLNPQSUVXZ[]_abdfhikmoqstvxz|~‚ÄņƈNJ endstream endobj 841 0 obj <> endobj 842 0 obj <> endobj 843 0 obj <>stream H|r硌 W endstream endobj 844 0 obj <>stream KLLMNOPQRSTVWXYZ\]^`abdefhiklnoprsuvxy{}~ﱀœÞŠƢǤȦɨ endstream endobj 845 0 obj <>stream H,‡B`;J%\SZ!. ѐqQS[M1=)1cK,)2qEc1v{kf[-6P1X>+ӫr_`os,uƳELpgi endstream endobj 846 0 obj <>stream HQwc(#` endstream endobj 847 0 obj <> endobj 848 0 obj <> endobj 849 0 obj <>stream Hw価 :y endstream endobj 850 0 obj <>stream H )! &yIr̲/tv 7µ6tŇo 6I\H>stream H2@PC:ܮ:8}߷m[uYyi7~軾mꦭꦬꢬ"$$4  lǷlϰ\t4VuK,Y5%e]4^T9AayJ4'QH2A8H%Xg4P Ɵxaw_> endstream endobj 852 0 obj <>stream Hs endstream endobj 853 0 obj <> endobj 854 0 obj <> endobj 855 0 obj <>stream Hڵ计 ꏁ endstream endobj 856 0 obj <>stream HW0_ Q6=D J` Ԣ')o{K k˵ͧb Q5YnĄB :>vBO0 ,JqVyծ>4=]wm<8o endstream endobj 857 0 obj <>stream ǾƽŻú¸ endstream endobj 858 0 obj <>stream HZb a~A endstream endobj 859 0 obj <> endobj 860 0 obj <> endobj 861 0 obj <>stream HI ?VAMQBؐPn=u2È?~N%ci 71GDJB%erńiZ8z!cL)9Rk0$2 endstream endobj 862 0 obj <>stream H‰D k-0o<};c 1+?m_ .[γIqVjp(ry׷\B a]C9&7-j AZִIQlg蓣F endstream endobj 863 0 obj <>stream ǿƽĻú endstream endobj 864 0 obj <> endobj 865 0 obj <> endobj 866 0 obj <>stream HzWn(#&kb endstream endobj 867 0 obj <>stream ̧ͩ˥ɣȠƞŜ̘~|zxvtromkigeca_]ZXVTROMKIFDB@>;97531~/}-|+z)y'x&v$ endstream endobj 868 0 obj <>stream ̨̧ͩͩͨ˦˥ʤɣȢǡƟŞĝۙ}{ywtrpmkhfc`^[XUROLIF~C{@y=v:t7q4n1k/h,e)b&_$\" endstream endobj 869 0 obj <>stream Ha(#[ endstream endobj 870 0 obj <> endobj 871 0 obj <> endobj 872 0 obj <>stream Hzա C endstream endobj 873 0 obj <>stream H`̡ ;x endstream endobj 874 0 obj <> endobj 875 0 obj <> endobj 876 0 obj <>stream HBq! 8$뺶mWuUUe|ʢ(ޯw,O,I8N((B>stream HZy  endstream endobj 878 0 obj <> endobj 879 0 obj <> endobj 880 0 obj <>stream H:zѡ 7A endstream endobj 881 0 obj <>stream H 0+Q@n ⍩Y,76{ z$)N sv$ߗH#2Xxy,$%"%U$ ʚWZȦR;{Mg~dyz_nZ׶c0<Ο endstream endobj 882 0 obj <>stream H… X9{wﺮ>stream H:yɡ &ƚA endstream endobj 884 0 obj <> endobj 885 0 obj <> endobj 886 0 obj <>stream H4‡C@)jǝ75BUU4=i(ZOGxϿ ,Is2y! +*T ABEI.DM[Hhay[N`G^aDigqYe^TeUWۦax endstream endobj 887 0 obj <>stream H> endobj 889 0 obj <> endobj 890 0 obj <>stream H@)3eDJ^Jys_^Ax~wڵm+*51J!cRUu@y^¬Ha<`( :\˾0L{g|OL{ 08; endstream endobj 891 0 obj <>stream H C@)N?#!.ԁ}" .7R@xb$ /*/iEِYf: a\y.z~QaDq'YiVdyeQVUUu4mv]k{i>> endobj 893 0 obj <> endobj 894 0 obj <>stream H ‰D 1iU$˼{וs>ϜҙR:Ǹqv۲p= NS*e2RQj1j! T?HPn- f f?Daݴ&.J)_\W endstream endobj 895 0 obj <>stream H$ ?ĆAb7dge9zy8.* !C  :Brي^t줒Aiͨy1c< \u]m8<>stream H$‹C @kJMe|'I4E8+q~'Eu/QBq[C0arve=\ʮPB*9*u֎qއ4y^e]m>q~ H endstream endobj 897 0 obj <>stream ȿƽĻù endstream endobj 898 0 obj <> endobj 899 0 obj <> endobj 900 0 obj <>stream H$ (MEH&/9&;[oJgHxغ Zl\.5)Qٖ6rItYqh'nGnFfӄꁪaV,Iv8./$Icx:?쁘 endstream endobj 901 0 obj <>stream HھvچCdhAj[h'+x endstream endobj 902 0 obj <>stream H0Oݰ$A("}Z;kʹiU /taFCEτ-;[rSp:oU(HZ RR㲅Q༆aV!RRI"8}kg/>stream H6{(#n endstream endobj 904 0 obj <> endobj 905 0 obj <> endobj 906 0 obj <>stream H|W0WDD "C-{lb˗GcgngNK:5t\}հ]ڢfi^i35L*` 'mZ.0P驆> endobj 908 0 obj <> endobj 909 0 obj <> endobj 910 0 obj <> endobj 911 0 obj <>stream Hڰu t endstream endobj 912 0 obj <>stream H< 0@_A-kMn<&:qޯaڤ J?Ҥq}OlF6k\Q3)/v)[_+Xۇ̝Jߔ>Q endstream endobj 913 0 obj <>stream HpŬ Cx endstream endobj 914 0 obj <> endobj 915 0 obj <> endobj 916 0 obj <>stream H\RB4 BE@XK*})UR\K֗ /_T|5Zgkf-_[u8}tCO>#~,$_k~mh{'98ϱEN{q{9`q> endstream endobj 917 0 obj <>stream Hw ~QA endstream endobj 918 0 obj <> endobj 919 0 obj <> endobj 920 0 obj <>stream H6(#gp endstream endobj 921 0 obj <>stream HY gKe؂HAGA?ax?!zf! cXKDjDjs ai=vH4æ&g7.{܏Eu endstream endobj 922 0 obj <>stream H@ r+tU|WCڷlSL-)(m?3j45%fQ EE2SEe0L@0b endstream endobj 923 0 obj <> endobj 924 0 obj <> endobj 925 0 obj <>stream H :A endstream endobj 926 0 obj <>stream H PD g  ۝e7P;]\Y'O7QzH(uH&fՕk6a<L= endstream endobj 927 0 obj <>stream HI ﹠°Π`'&X)9.u|x&c0VZ͢$8XG^BC|P+GrP-D endstream endobj 928 0 obj <> endobj 929 0 obj <> endobj 930 0 obj <> endobj 931 0 obj <> endobj 932 0 obj <>stream H$  ߧ, (Q˺Ko-+cRyc2>066k(/&Oڋ,r" 81T-U 0~{Qwٍy;a endstream endobj 933 0 obj <>stream HI0c4he@[.O^>o~2qS tpnh[HU uѴL# w"W+1-ZrCݥY<1_] wӄ# endstream endobj 934 0 obj <> endobj 935 0 obj <> endobj 936 0 obj <>stream HL d/w7M_^דz}"pbXXDNDBT#g %gGc3 p $.k/&KO--W{*Z߹y;J| endstream endobj 937 0 obj <>stream H  Oi恈""Zf},vv_~CLo1q烺5Z˥JTLv(7}ȌI:Rj1I㲉 yԬ jZipK27V;J?Pb#M04o.\_s 0E} endstream endobj 938 0 obj <> endobj 939 0 obj <> endobj 940 0 obj <> endobj 941 0 obj <> endobj 942 0 obj <>stream HI0EY&/̅GD'{?a_j<0lF ;LL/6O[\\~Kzy 0;A endstream endobj 943 0 obj <> endobj 944 0 obj <> endobj 945 0 obj <>stream H$ '.J%ފ^"THYY-+[^vF{5 -C6pMPXr樖qB'K ʆF='4K6.[%l..>!!q}JەW߇x endstream endobj 946 0 obj <>stream H  Oz"(xCcS 3W[FfA^!11UNKrqE%&cPBٲp:_C3J;*;)77nnE+͌^nzׯ?` | endstream endobj 947 0 obj <> endobj 948 0 obj <> endobj 949 0 obj <> endobj 950 0 obj <> endobj 951 0 obj <>stream ¼ýĿ endstream endobj 952 0 obj <> endobj 953 0 obj <> endobj 954 0 obj <>stream Hz *#* U*"w@DJ5ߕi+~WRCj5FjM>ԛ}hdcvǏ?z<1Ӣ̈2;o--nm׾Isb߳+^`Y5np endstream endobj 955 0 obj <> endobj 956 0 obj <> endobj 957 0 obj <> endobj 958 0 obj <> endobj 959 0 obj <>stream H  8@A endstream endobj 960 0 obj <>stream HT‡ 0 ĎK_Eq?o3JoQXeιNx$)l$< endstream endobj 961 0 obj <>stream Hrw d8 endstream endobj 962 0 obj <>stream H70 _ Nlageпvި>ǂal1%1hC"ȯl NF_ 5 endstream endobj 963 0 obj <>stream H23 , endstream endobj 964 0 obj <> endobj 965 0 obj <> endobj 966 0 obj <> endobj 967 0 obj <> endobj 968 0 obj <>stream Hzov(#cA endstream endobj 969 0 obj <>stream Hzo*@FF TA TD&om-x[fmJUo8uzW]fwu ~/OI|?=ìs?+?i㖮O;?OG~> j|p endstream endobj 970 0 obj <>stream ɨɨȧȦǥǤƣšŠğÞܛ}|zywvtsqpnlkihfdca_^\ZXWUSQOML endstream endobj 971 0 obj <>stream Hz7PFEs endstream endobj 972 0 obj <> endobj 973 0 obj <> endobj 974 0 obj <>stream H8#adBS?N"SM?N38tO-?Ͱ4LO?v4\?"/, ,ˊI.o m-{~hq?Oun_]?yt ` endstream endobj 975 0 obj <>stream ׽ջԸҵгΰͭ˫ɨǥƢĠ}zxurpmkhec`][ endstream endobj 976 0 obj <>stream Hz?%PF4#w endstream endobj 977 0 obj <> endobj 978 0 obj <> endobj 979 0 obj <>stream o1o1p1p1p2p2q3q3r4s4s5t6u7u8v9w:x;y|@}A~CDFGIKLNPRTVXZ\_acegjlnqsvx{~ġǤɨ endstream endobj 980 0 obj <>stream H|rg -:ӱE.tt#?Of:8ӁOwʧ=?Ώ[>nnk+>*Ò Kx?+ݴw| S endstream endobj 981 0 obj <> endobj 982 0 obj <> endobj 983 0 obj <>stream ɨȧǥǣƢŠğݜ~|{zxwvtsqpomljihfecb`_^\[YXVUSRPOML endstream endobj 984 0 obj <> endobj 985 0 obj <> endobj 986 0 obj <> endobj 987 0 obj <> endobj 988 0 obj <>stream HXc(#v endstream endobj 989 0 obj <>stream ӾѼкϸζ̴˲ʰɯǭƫũħ¥ endstream endobj 990 0 obj <>stream HCBB{WڶmW//(ӼH>stream H4 `?=0pw}$'RJX6CBC*B4J1:YL` [\eU|mgBc.4BlbZuiH}v=2d`BhlK\Cjg l ;C僥jhg,?yvݯOE_v endstream endobj 992 0 obj <>stream ›ÝĞĠšƢǤǥȧɨʪ˫̭̮ͰαϳдѶѷҹӻԼվֿ endstream endobj 993 0 obj <> endobj 994 0 obj <> endobj 995 0 obj <>stream H\ p+D$͌O[k49r$oۋ_oIAAhЛwPlr"0GJBce1^$) Sr o"b:X+=1ZC3ԩ#5b0[N[smZ{x8]|?m-!8 endstream endobj 996 0 obj <>stream H|[P?rcƌ䤢Nc45ŷXߥe(T+5*_Zl~6-uhݠ#Ye*CNmNT0fМ٤Ph.{:G䆪dAtŗ8<β# endstream endobj 997 0 obj <>stream ؿ׾ּպԸӷҵѳбϰή̪ͬ˨ʧɥȣǡƟŞĜژ endstream endobj 998 0 obj <> endobj 999 0 obj <> endobj 1000 0 obj <>stream H:/uj(#P endstream endobj 1001 0 obj <>stream _`acde g"h#i%k'l)n+o-p/r1s2u5w7x:z;{>}@CځEڂGۄI܅L܇N݉QފSߌUߎXZ\_acfhkmoruwz|ﳇÜŠȣʦ̩ϭұ endstream endobj 1002 0 obj <> endobj 1003 0 obj <> endobj 1004 0 obj <>stream ӿҽѻϹηͶ̴˲ʰɯǭƫũħæ¤ endstream endobj 1005 0 obj <>stream H`?#%kIS$tyRfJea*< (Ҍ.Lesuk\[^]=RҀ@ʘYOXbU \NR1VkR-Dӕb{svM/'"?5ܢ[|x^O$_bw endstream endobj 1006 0 obj <>stream H4i`?\9Rݑ$:h/=%S/Vy/QPABU l k\$!FQb4ʣ>stream HTi1%I)LkYk91|H'o/C߰Q d$JvTNtf]&y-E+26|BԤI-FSᑂUT0qNH J^15|;YTtK3vKXas't>x ɢ endstream endobj 1008 0 obj <> endobj 1009 0 obj <> endobj 1010 0 obj <>stream °ñijŴƶǸɹʻ˼̾ endstream endobj 1011 0 obj <>stream }|zyw~v}t{sy~qw|puznsxlrvkptinrglpfjndhlbfj`dg^ae\_cZ]`XZ^VX[SUXQSVNPSLMPIJMFGJDDFAAC==@99;335,,-$$% endstream endobj 1012 0 obj <> endobj 1013 0 obj <> endobj 1014 0 obj <>stream HI ߧќ5l2".}hѪM<- b*HFEm`itL\{imGGg0z,Lu 0A endstream endobj 1015 0 obj <>stream HD ?M* J>-|kiMnܫqSkۯ_Yy\vMF-rM.oTVnS&JJEQr*J )B}{8sc;}F;"70v@tO^x ~ q@ endstream endobj 1016 0 obj <> endobj 1017 0 obj <> endobj 1018 0 obj <>stream }.}/}/~001ـ2ف3ځ4ڂ5ڃ5ۄ6ۄ7ۅ8ۆ9܇:܈<܉=݊>݋?݌@ލBގCߏDߐFߑGIJLMOPRSUWXZ\^_acdfhjkmoqstvxz|~„ĆňNJ endstream endobj 1019 0 obj <> endobj 1020 0 obj <> endobj 1021 0 obj <>stream PQQRSTUVWXYZ[\]^`abcefghjklnoprsuvwyz|}›ÝğšƢǤȦɨ endstream endobj 1022 0 obj <>stream Hz35 2G!?4^#_h s endstream endobj 1023 0 obj <> endobj 1024 0 obj <> endobj 1025 0 obj <>stream Hli Aa-1D$$IRRRJ<"I$˻lq:RQ&)-)R]*wjj nVm ڡ.츱{>qaCd&Eyv,S+"om~?$F endstream endobj 1026 0 obj <> endobj 1027 0 obj <> endobj 1028 0 obj <>stream H,JWA $$ % %)C]j-*&Ƚ͙|7ܼ[N\_q~ɟ,Y(N8 ~qg|EۃhFͅ>*NӆE {ț3!dx7M/:yٖg> endobj 1030 0 obj <> endobj 1031 0 obj <>stream Hmq(#k endstream endobj 1032 0 obj <>stream 23569:=?BDGILNRTWZ]`behknpswy|‘ŕƘțʟ̣ΧЪҮԱֵٸڼ endstream endobj 1033 0 obj <> endobj 1034 0 obj <> endobj 1035 0 obj <>stream H Bo0~Яo}W?흿o}y 6ENu|C]?5Q}K׵_G|Yyݧ)$D endstream endobj 1036 0 obj <> endobj 1037 0 obj <> endobj 1038 0 obj <>stream Hzv(#_A endstream endobj 1039 0 obj <>stream վӼѹжγ̰ʭȪƦģŸ}xtpkgb^XSNHC<}7y2u-q'm# endstream endobj 1040 0 obj <>stream m'm'n'o(p(p)q*r+s,t-u/v1w2x4z5{7}9};>@BDGILNRTWZ]_cehknqux{~flåƩɮ̱ζһտ endstream endobj 1041 0 obj <> endobj 1042 0 obj <> endobj 1043 0 obj <> endobj 1044 0 obj <>/ExtGState<>>>/Subtype/Form>>stream HL1 0 =LvvpPP*HN'> endobj 1046 0 obj <> endobj 1047 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@[ endstream endobj 1048 0 obj <> endobj 1049 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1mPʕ`\  endstream endobj 1050 0 obj <> endobj 1051 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@[  endstream endobj 1052 0 obj <> endobj 1053 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@PI endstream endobj 1054 0 obj <> endobj 1055 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1%VT4.[j endstream endobj 1056 0 obj <> endobj 1057 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1%VT4.[-  endstream endobj 1058 0 obj <> endobj 1059 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1.rq[ endstream endobj 1060 0 obj <> endobj 1061 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1.rqNo endstream endobj 1062 0 obj <> endobj 1063 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1.rqZ  endstream endobj 1064 0 obj <> endobj 1065 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1.rq[ endstream endobj 1066 0 obj <> endobj 1067 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@f. 4 endstream endobj 1068 0 obj <> endobj 1069 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1.rqN endstream endobj 1070 0 obj <> endobj 1071 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1.rqQT endstream endobj 1072 0 obj <> endobj 1073 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1.rqN endstream endobj 1074 0 obj <> endobj 1075 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@C endstream endobj 1076 0 obj <> endobj 1077 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@[> endstream endobj 1078 0 obj <> endobj 1079 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@ZL endstream endobj 1080 0 obj <> endobj 1081 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@[  endstream endobj 1082 0 obj <> endobj 1083 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@OS endstream endobj 1084 0 obj <> endobj 1085 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@P\ endstream endobj 1086 0 obj <> endobj 1087 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@O endstream endobj 1088 0 obj <> endobj 1089 0 obj [0.0 0.0 0.0] endobj 1090 0 obj <> endobj 1091 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;;_  !} !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?g7MV9<9u4S_?V,t6;BnЛd:.˦2xX~_Ъ'7 V9J<u5S_?\ltбw7xIu]cX9~?Vѥ=|+cf͏Ʀ?8cX o}脝'he9u]#L?^ՁҠO>k&7 MV?Fl~jc:FXMwo>k2 .ˬrOɾisq7ߍFo׉FnEr}U'\D2!xe9u]0X~?/?O>k$7M3~f&qf 7\UR}UW^_D2!he.t O>k$'MS~o&qd >O/w]ba~@-/>[$' IR~O$qd >//wbL?Vm/ܾ[$' IR~O$q$ >//v]"/ܾ[2g Y~ߜeXeW^_]Y}e՗V_]o[X^n/ܾK2\_=_9v]/rj/[Au .|W>;r/yr_9~4~w/iT}UDX^s|8MNy~X>UOKT*}UDHa sZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇsZ-|8MOїW }>_m/S hEׇs|8MNy~:ESi}>ʟUox;E.~?/?.|W>+p-ÔՌ?\p >S}5;.~?^n>K0lÄ,?Fpi0qì0+>pj}>Uoh;E/ׇ>Kp X~/0qì0 >>ʰV Xx~_m>K0 EQ~/Ո\b/>胴L?VؾK" EQ~/"qb>wbL?V/Ⱦ[" EP~ qb/>kD0 ;E.~?V/Ⱦk"A0~ Q`>k/kxa.t /Ⱦipq@Ո:Eq}UW\_L0 ;ô]"a~@/>yprnysYf+~VqwEp}\_D0 ;Cì]"x~?8~_Ԥ/>ypqnR3[RߜVX[kv>Ew]h8t0x~?Vժ<88η)Vߣ5?ԧ?V+~a[ ;":äpa֮g cR9~ӧaӰ~cՌa8ìqhch.tx~?/ endstream endobj 1092 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/2753443U0BS30XL\HD!9K3@%+ J endstream endobj 1093 0 obj <> endobj 1094 0 obj <> endobj 1095 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,,x"  !1AQ"a#24qBR $%&'()*356789:CDEFGHIJSTUVWXYZbcdefghijrstuvwxyz !1AQq "#$%&'()*23456789:BCDEFGHIJRSTUVWXYZabcdefghijrstuvwxyz ?%ݕB$*cmj#+SkaVV՞ [VRaXT2FHԹuG#^RXyz0.EZ3!<AQL2 I.j£1\iF lH4qTͺ58Đ1jH 5? XYLnjQg)jk$7wzj8G[RQz&0]\Ggo5rkN9;>szܚj]xn+rҹ8֦CkMr\VN -&a2M O*4f\lwJ6\6-b!*P2&{/V fD7xhe)?di8wS\N^x[5XT$<x93K^8uSWDDiQ '(2QUZf'ZdPm׏-V8^CsТHB$O -c-P!ML9W%!Rlҋ mEE U\XiO=kn*8CDcֵ- 7Bשׯ\8o&u:^4Ҩ:kkӘuH,MҬgu Bc JXӅy#A{ZI!"LO>1ږ^})),qg5 9{: *\S%Ƚ⡛* @zzJfFg%4PMCkcD2Z9Xy4b2ګ,Me|mTff%Ԋ1֣(Cp>6S!Gc^iׯf507 5!5ÂD]]k@-U2rȲ=yI;%PCzLkP[[T)nt$(յ0cAKtNΙTVR)_AQ`+-4NA\8>4jBšZސ75e8״j58䥀5%FX&muꏮ%4>6:Fi:E&b|(iNXTֽlRWB`l6/k~V&: HZyN,>PNUN-La5f&ʧx{NJU`Fp7&Z2pa.J[0娌qZcZz`*3(.Bڭ 4f05:^qLxF ڈv_^SY< ps`nk@whi@FXTrt֔VW7&ɥ$K5 @MX4\r \/hD)P+TtiTaQ\03dW;Q556%AkVF QK5IC%a #ݽ\`X륪 0Voq(R*je y0<(R/RG Y*BV*FQ0 8=T1+bHB2b[P8&Riٍ0iKsYc+Mxd𧖽ÞZ٢%jƸkOd,vJL^bd.ُlݑ Z*XaFIVRW^DX*bo:߭= X-5Ҭ%- W (zoUQc}(0)\^>T^J)H·Z3$M"SEQ?ҸIؓjy0Lfl=*ĬkIJ/3hפ aY #m*h|Ȉ--%4,!rRӡHԝj320XoU !O $䎨U zYLDcj&bMUf1QJA?Xԛn^:&XF,XXn6;^<&Byxf-ZҧP54ꌨ&!WJ(QKY ) LKZiʛ^oqQYM$iT.154qAnSuÃ0Wb  UT$ G*&Z|P:&)\jio34Gff^27Ƞ+)$[j-׃;Mxln>5UU*dJ%ŧ^B4s<ȤhiJi Pe7(L)]41Сʃkjj^pmz#<#z &CcUZ714ՓRi5lGx K p50KGJ0,\^P5mY? fIqMQ$1MF Ym\3v{B'aN,mL hb\5Tpx؃qma0m,,w׭KXjG*t@. jlt&fF7p7ks44FF: 㫻;f6b8W7` P,(=0rsl9^֡(kFXN7pK PUxZ2#X[p*DӎlUX%us,GcOג,{SÜc-Ļmu:ZΒ;;Yfv7&|((IJ eȩ V\y&N )f;`l|,m(yS1'&>"S<)!duOdd[nPji,HRDžP9Spyb+pF R w_Fהk\2XCz}B㖰p$"i ? r4Ub$G*)/jf22cAUu)'(U#t:֬S; Q-ݵ'ZQwR"|(Fo^ƙZcNIPkGnT|-p&s{S[QNK\8KzSxc\c%5c)a7ЁR7PNѫ{71Iު4e't.Id(/QG<1SWxV@86J7Sj%!S$Ro@U F}d}5Tc-=UX+1=֣ -M؈ iN WY(h) I2k(p&z:pTꪣ-Ѫै݈Zm6%BȚ+k)ڤdR7ڡy ֆxS3Z570#JcW s^/QpY؍8瀱R,T4\c]&~xVX㓼}4Pk`CzW\8Yb+֤"f&E&Jpwu5}3VN X,7T) qׅHY8*5j+7(#YbPZ=891) zRuZ^QXc9Zc9TL0#=<Ƒ׊%xn^8x%5HXWpPu4wJr)e\9=Eko05sU3zFS $QMy㾶5ZF22NSۣP—<*"!SPi0ZL T-dqJ,j2t>;q֥=ƼUso^ELaNXsjj))3 aqL\;[uinX+6ĂK\I 䳒O7 sOZhԫP aab1V%!ROGQR?F[) 2qЯpDuשQX*5wR)֯Z iM7JZp[Jp:RޙzPiKQOSzi*3ol\ "4*dR{f/7ͼ SI%gXFml8O1}HpX6blFnNc쨔cqwO0*MbXz@53Ft@ PMbɭ2\f2M;WBP`8g=RêAK& 'Gok4T\Q/?!siw9[$g)Xɘzu?R4Jll#@PҠ2;AT<n1mZ3f6ƚ$ĪQrmM:`Sgԁ:ŃV$ k#Ʃ|tBm=!ҫbv'UU/ "7BJG  yr\_V%R2ʳgʲ.[o`;I H8em˹lw8b9LIyQde7*Ā VL X&||ٞX+ @3 XE2i% !%dM Ҏzi ׃Μg&Y1=Zةyȭcex{zhYr)!!HP_0mwIeW>@4f\eR{1²͙9>TC2mZ$ff-.-J[Rl+J#H%(Ur"A.Q2KXY:Ǟ AALǶpNc#2MNquRhyp2nQ{ jA LDs/lĖ+F:v*6 w.*SG6AH#FI ar }z0cffA$2(^Qhav~N\DH,Mp  :1-rx7dhu{{m sjs7N*䘩)PBL6cI d 0Ĩ w5oIմ"$%$3"U&brjaQhb $̊QXK˚_Z 1i\X8בXivfJ1)) 8,DrUyۋ&# GUa$l@ R\^sӎq/"H8x3;]F_%L{ #YHAm9Qk [XJe\^h"6*Iˉv,ōno:d/ǭL.ا.(g.Z3(f#v ݋/ְI_;ƒ'DX4Mqqam4\b+u~ Z:(hU٠fmMDj͹o=V3hcqA`H݇f[ƴ3FA\Rh"Tfk;+O&{P3Xd793ikjPmQuI vk\_wji8"37 6*9^fnehǺR]iݘpsoEOE1QaCbObp:ִ{gN &I\vœWV3tbᰑYE(BP&Rj)gm!p2TQuÅn@!-{kW[F&@ty#IkշEȶ'# qZ0{CY`eyOŘQ ^J.Tpl9 ڻ1o<5q]xX`V,CbKSglOZeg*Xa(ʅULq3Ə h1'H߂JAmO4XIbV8"\$8s$dn3C8=D>u2Bwn*bۃ3`\B%(c4jq߂1>4y)]@Nax*U„K2.07Ӧ 4 Ή'svQKڻ  V(8qq,JͶ1glAyWNt:5v<oņHPI Tevl&l|3yU Opq3ciFF<' - rq+,IqXŁxx1yxpKmlYAM jdc2ŪӒrٹuN|."'Fpѫ76A76UǶ JK#M..k lx+uI^c+:_)Nl.z)8^x'Y`BFbXiǾ+l!8Tu r@+YMK CA+ƹ1fHƺFII=uW3Ɋa"coYEu]t;:y"1ybdD,ʖ;=M$\>B2 /h4a1jNnsC"C[%0dE$uX~h1؜H$&4yٮ{:$Ȋȳۭu6Zk1e,`U hU6P+iY)qn8#i^<똢˸rU9Wߧ13Y6t r:(FN0y#5bNvfVt›nK.&FcAϛsW| M$=SpKuR +2E;\s%|0'8qd%,}͉Luׇ-t91Uw6֩O5X4ƸX֌5X}VE|*]c' RHKaQ͂I B0egl/쫎 }.@՜,g0Q%Kb{#jOWM+,z[T ZiX@CH:iqJWٓ,J,ηd;M30(ٝ3؀" M bV`fn~IhrߒK+ȱw[f.!mk%Ewre2YZ%MAg&m~>3OLaO':\sUEpߞӎI6^| ۝{uxF̅JH6l$YZT6ӶM8 K+,CBNDU:dp*~)rtDw`pdEsU\; W #yS9V\eq{[qfk \<$Jrg'[hz]*5,Y%  J.?1ț,4vv[ ѻi]f;_V r.tqS;`쭕 #6&&p\* NzTΩl; /*.h'e]`m~yk}:tX·k2dRNb2Jph,cWN`*wJ}(*YGI:_֧Vl=s:\ H ':y\.#`*匍o햲"ÃPqvv`b.;46y*ec&E.ٯ`NN] [;|4i4#cdm1㦀-X-MӺXe3;6܂w{UL/杈?_lՊ ;%*LW#) f=ֳ񘩣8f-6^,ǿ5MET:o{ahBfE,9 n孔c lequwR|Ėv=v%߇ &TӚ,"J%F]ճn:]Vfl2D!Vͪ`9"׎޳dnjO-8/}C&513ų4lPM]g?a=xj#S endstream endobj 1096 0 obj <>/ExtGState<>/ProcSet[/PDF/ImageC]/XObject<>>>/Subtype/Form>>stream H11 {b?c'NΩABD@u_"9mNV3T&Xu^F;CZH*n d$h|M<G\Smp[/GyZ?`zۦ[ۼ*l8e)|x_!"u endstream endobj 1097 0 obj <> endobj 1098 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@7u a endstream endobj 1099 0 obj <> endobj 1100 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@Db endstream endobj 1101 0 obj <> endobj 1102 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@D0 endstream endobj 1103 0 obj <> endobj 1104 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1.[ʕ`[ endstream endobj 1105 0 obj <> endobj 1106 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz11PBLTAD(+ [_  endstream endobj 1107 0 obj <> endobj 1108 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@g 8 endstream endobj 1109 0 obj <> endobj 1110 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@g 3 endstream endobj 1111 0 obj <>stream ~9~:~:~:~9~:~:}: endstream endobj 1112 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,, "    4g1 !"#$%&'()*23456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyzQMQ !"#$%&'()*123456789:ABCDEFGHIJRSTUVWXYZabcdefghijqrstuvwxyz ?<A6@Hq5 . a0A< endstream endobj 1113 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,,"    %u" !#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyzWI! "#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz ?T)"|Pd- 1!J,@ endstream endobj 1114 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,, "     !A"#$%&'()*123456789:BCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyzWI! "#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz ?Z@pr!9 qi)r tr90(P0 endstream endobj 1115 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,,"    ;a!2 "#$%&'()*13456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyzDW!"2A #$%&'()*13456789:BCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz ?P!Ѹp`x>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,,"    'q1aq !"#$%&'()*23456789:ABCDEFGHIJQRSTUVWXYZbcdefghijrstuvwxyzGU!"AB #$%&'()*123456789:CDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz ?_&$8!*'D>8G$.GAJap endstream endobj 1117 0 obj <>stream G[d} endstream endobj 1118 0 obj <>stream .8M>Ol`xˡ endstream endobj 1119 0 obj <>stream Hz(0\U endstream endobj 1120 0 obj <>stream HP0 A endstream endobj 1121 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,,.,"   ! "#$%&'()*2a13456789:ABCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz;aa !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz ?8(!@N B @(D0D"FA ЗB $`dRX!"L f0pFC LOH0>BpAlI%9)k1J"NIAPqIRnsGE0J Q(p㌈~C)$ C>stream H*..*ϯ˭(516,.*)/ 66/((*-r7.ȏHOrwfez{y;h${8HYz%':JK YZx%%9iHIM<4UJLM=\b4U8,-L\bc4Tx9LML (+ 2k[[)03hi*)ʋ ps112mC endstream endobj 1123 0 obj <>stream HbgeRVa06`gaR YYs1)0J̍9u5UdB@U<@!m ? HHEI^JB]X_G[]E( rL3 B\BfFZj*!>^n.vfFzqZj!r~>@ 3@H(%)6:*\!(.+49"H E<]rs2Sb S8 endstream endobj 1124 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,,"    8c13 !"#$%&'()*2456789:ABCDEFGHIJQRSTUVWXYZaqbcdefghijrstuvwxyzMQ !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz ?V$@!DQ҈s@EC?cpc7 00Dh_ endstream endobj 1125 0 obj <>stream endstream endobj 1126 0 obj <>stream H[`Ӣ +%LZ2X8G aarp6u_|ﮯj6N&x4Դ~V[R>W3BF6w;jQVrxRŠ;ﴛu|N~XUr&9IlATU 楬 +) ҩEL=NU/fFZFJBtF]AXO&x;X=y,)+ i>5s4:+R*rRF8Sx,:$2*HQG؝TNaW;ـҮ.VU 4 (qa[hW=`U~ Y^+tN!PûAoTQW\IQW C_kCu0"ՏD,UY6,S'7e?Tvce٠aT4 ^@F@5 Togײ*%tYB¬" av<S:5Zqģ``ro_yV8U+ Bm{cݕ >+0>D}Z_K Q$Z,~pon^,*^qWH'XV]s>{+ %+jtb5SԙyW^aW/ǫO, 'p~v޹ʣ 0Z endstream endobj 1127 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,, "   OQ !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyzWI !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz ?z@0  endstream endobj 1128 0 obj <>stream HzP`c endstream endobj 1129 0 obj <>stream Hzޤ20b endstream endobj 1130 0 obj <>stream Hzl5Cp`Ϗa endstream endobj 1131 0 obj <>stream HzlI i2 endstream endobj 1132 0 obj <>stream 4333 endstream endobj 1133 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,,"    2g1 !"#$%&'()*23456789:ABCDEFGHIJQRSTUVqWXYZabcdefghijrstuvwxyzNO!" #$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz ?Q*LKXA2!@"P@ leLBR)PE endstream endobj 1134 0 obj <>stream H˲/K`0  endstream endobj 1135 0 obj <>stream Hb````S3w H-lhoTwXtJAYMS{Ӡr< yUm&O1rʨZeTԃ`BU endstream endobj 1136 0 obj <>stream x'x'y'x' endstream endobj 1137 0 obj <>stream |){){)|*|){) endstream endobj 1138 0 obj <>stream HzR$@ # endstream endobj 1139 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,,"    5e!3 "#$%&'()*12456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyzGU!q "#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijrstuvwxyz ?P$hpPDDH @b08`\|%<п endstream endobj 1140 0 obj <>stream y1~6CX:DZxQdﴆ̨ endstream endobj 1141 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,,1"    !1A"a #$%&'()*23456789:BCDEFGHIJQRSTUVWXYZbcdefghijqrstuvwxyz !12AQq "#$%&'()*3456789:BCDEFGHIJRSTUVWXYZabcdefghijrstuvwxyz ?qT䭛B٘TM*sR=I|Ԛ7Q &IHPe-e0*{$AyVI-]1EinB4q -6Ei` 1FeA.PS " *lJ,/MTj EӧPM&c˃q"gHI1P)E@7JҀ PqǞH4&' H@*OTr*ѥ)"UˣKz>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,, "    MQ1 !"#$%&'()*23456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyzTK1 !"#$%&'()*23456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz ?ZXab@0 endstream endobj 1143 0 obj <>stream ҳѱέҳаά endstream endobj 1144 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,,7 "   ! "#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz/m1 !"#$%&'()*23456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz ?)C@(Bc$Ж"ȳ B@>stream Adobed     '$''''$25552;;;;;;;;;;   ####''',,,   ####''',,, "    DW12 !"#$%&'()*3456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyzKQ12 !"#$%&'()*3456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz ?TEa ` 0 C endstream endobj 1146 0 obj <>stream nnnn endstream endobj 1147 0 obj <>stream HT aBT<$PJJt7+L^J(-a9R d_"l IsJ 8 B,8ݥғ]$B 'FE_Al@3٭>tEad v< o^ w endstream endobj 1148 0 obj <> endobj 1149 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text]/Properties<>/XObject<>>>/Rotate 0/Tabs/W/Thumb 2088 0 R/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 1150 0 obj <>stream HUn7}߯GV$WW(JKP^ uQP+JbTR})D6¶,s3go}rMֿueWq&Ռ a'~WRPQt0!5o.:Gߕȧ#I"GL-HRʦ)锊)%&QB?Tq)O ds.\[:'Wkƈ!NPOJ)*cQk%-1-:͸bWC{.i_dSؘÕoCB5dij\g(X>֞7V=9Jnlk5=润C_9hiX000! &BzR2nb Bv`3倚%mL+܆z$7ڶ19Ejgj>OMqr9(h*ozrP5mWP?5%2v֓Fy :5o%ī.Gl6ZZAi׶5NF 6poh@_>SC!hMZqJ Sv'=c'4 ׼'&U]wP0%~V w0w0 kver @\QTSlAM /M:t|ŋRvl;f2CYOO!PU|s=U:4 ?\yk6V<XgtGڜdqH[ v_<>_m>hx>jV >3/H*OZDm:\Gqy8/p~mm2N>@VW6p M_)9SYsz"O)=TL#r.dL [ 6 /_wuT[)b< _$V״b_;0-4zJ} =TgrFRmJ[ҶEcK\٠G̈& '1P^_F1 endstream endobj 1151 0 obj [0.0] endobj 1152 0 obj <> endobj 1153 0 obj <>stream AdobedC  "$*$ $+(( $)%%1/%).*++9+*./45554/;;;;;;;;;;;;;;;;;;;;;8   ^C !"#$%&'()*123456789:ABCDEFGHIJQRSTUVWXYZabcdefghijqrstuvwxyz?ЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪժ֪תЪѪҪӪԪ endstream endobj 1154 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H,; 0E~V6`2?  b (p/$(7Pw$ŽҌ.*H$fR>Y6a);;i,^6 endstream endobj 1155 0 obj <> endobj 1156 0 obj <> endobj 1157 0 obj <>stream application/pdf stripes_product guide 2012-09-07T15:50:36-05:00 2012-09-07T15:50:36-05:00 2012-07-03T14:30:58-05:00 Adobe Illustrator CS5 uuid:26608696-4dc4-5645-bca1-5499576d0e7b xmp.did:02801174072068118C14B223EB52A9CE uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:b3d371e2-a28b-cd4f-9369-1deffe06b719 xmp.did:01801174072068118C14A3205A45E773 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:F77F117407206811871FEEFC10EB4007 2012-01-09T16:49:32-06:00 Adobe Illustrator CS5 / saved xmp.iid:01801174072068118C14A3205A45E773 2012-06-29T08:11:18-05:00 Adobe Illustrator CS5 / saved xmp.iid:02801174072068118C14B223EB52A9CE 2012-07-03T14:30:56-05:00 Adobe Illustrator CS5 / Document Print False False 1 1224.000000 792.000000 Points Cyan Magenta Yellow Black Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=60 Y=100 K=0 1 CMYK PROCESS 0.000000 60.000004 100.000000 0.000000 Adobe PDF library 9.90 endstream endobj 1158 0 obj <> endobj 1159 0 obj <> endobj 1160 0 obj [0.0 0.0 0.0] endobj 1161 0 obj <> endobj 1162 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;;_  Qa !"#$%&'()*123456789:ABCDEFGHIJRSTUVWXYZbcdefghijqrstuvwxyz?@xxx_ br'ҔJr}'7ҕGҕGҕGӕWƫW5_j^.]ٗveݙwf]ٗveݙwf]ٗveݙwf]ٗveݙwf]ٗveݙwf]ٗveݙwf]ٗveݙwf]ٗveݙwf]ٗveݙwf]ٗveݙwf]ٗveݙwf]ٗveݙwf]ٗveݙwftW _,*_8}H}X}X}h7քSS@xxX}9b2NO9>NʣJJʫUƫW^/Kt].Kt].Kt].Kt].Kt].Kt].Ky_,*XU}L*qѨo >@xx/,_JX}NO^޼7ѝGѕGѕGҕGӕW5_j]x].Kt].Kt].Kt].Kt].Kt].Kt].Kכ8U|UWԍGՍG֍GօGׄ^{؄WS@xxRў/^rz$ITלBs} }T})T})T}|qTt].Kt].Kt].Kt].Kt].Kt].Kt].0aQ£ &)ӓ٧'@x|q|q|$r})b3gOSROVI=jzӛNo9>>>5j>8x\. p\. p\. p\. p\. p\. p\. ǜ*>XT|ЛBo s{4iSj@x|q|q}9>JO<_BxybjbjT֩'9y'7єJS})MƣG p\. p\. p\. p\. p\. p\. pG 8c7ՌZ}xMS٧'NOj9>o@x|q|1|$R})} bbjb*Uթ'RO^rzo)xo3xk5fYk5fYk5fYk5fYk5fYk5fYk5f&a7 fBo ISڧ'NOn<__7@x|q|1}9>Fo7О/Z/V/V/N/RI=Zz$NO)xo3xk5fYk5fYk5fYk5fYk5fYk5fYk5f&a73}Hc7ք^{ا'NOn,^,__7@x|q|1}9>Fo7QTUUԓ֩'9>2JO d'FQj5FQj5FQj5FQj5FQj5FQj5FQjyO|'ՌV2}hI'NOf<^,^,^,^o@xR} ޽GSWW[WWSS<_Br} I'Ӕ dc'FQj5FQj5FQj5FQj5FQj5FQj5FQjyO|'ԌV2}xIاڧڥܥܥܥ@xI3} jZԪ*b**bjbמ/<_JX|13333333333333333333333333333333333333333333333333333y _,1|Վ/ ^1{4{4{t{{{{@xr})>޼޽GQUz^gWWSSS<_Fx}9bxfffffffffffffffffffffffffffffffffffffffffffffffffffffo8baGԎ/ _Zb)b)=/v@xr})BoZ֨*:JҪJV֛M&R})>8 Ջ )OnܤhOa@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛כdr}<_^,R/փAS{47IR{^'@xr})BoZ֨*:JҪJV֛M&R})>8>x>q}X^MR{t'E{@xr})>޼޽GQUz^gUTOО<JX>|12222222222222222222222222222222222222222222222222222y ,0|Ն 0{{T{t{I?@xI3} jZԫԫҭҫԫԩթמ^x>}`r222222222222222222222222222222222222222222222222222222y 8C <<,,,O@xS} ޽GQUUUUTTOМ_FQ})E8Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4^p_8cՌ_Z{SRd@x|q|1}9>Fo7SSSWWWSR/V^/(1|1_&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii4M&Ii|_8#Ռ_Z}xEӋ٧OKKK@x|q|1}9>Jo7SSSWWV/V^HjzN/(>x0xh4 Ah4 Ah4 Ah4 Ah4 Ah4 Ah4  a0}Hcք_^{٧N/j^,,_'@x|q|1|$R})} `j`j`*UթR/^q} 'єNP}9A0xh4 Ah4 Ah4 Ah4 Ah4 Ah4 Ah4  a>`B>"iӋڧJ/r@x|q|q}9>JO<Bx=z=j=jzbjEԋ֩8>2J(>4i8x[-el[-el[-el[-el[-el[-el[-e)XS|F>`Ѓb8q{T@x|q|q|$r})>}ש֩R/V^H=y8>RRcMƛ7el[-el[-el[-el[-el[-el[-el[y›7 oii`b{iSڧ@xxKҖ<Bx>ET֩8>ʛʛʛMƓ'OEhZ-EhZ-EhZ-EhZ-EhZ-EhZ-Eh' o8}H}H}h}hAׄ8=q{4_@xxҖ,Bx>R^pzN*o*o*o*O'O4-xR|=q{@xxӖ,JX>3N/8>2RRrx|1cIOŢhZ-EhZ-EhZ-EhZ-EhZ-EhZ-EhdaI O<)>i>i>ii @xxxR}>} 3і>,0}

p#0}hC Z>Q endstream endobj 1163 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/2753443U0BS30XATLHD!9K3@%+ gZ endstream endobj 1164 0 obj <> endobj 1165 0 obj <> endobj 1166 0 obj <>stream Adobed     '$''''$25552;;;;;;;;;;   %%#(((((#,0000,7;;;7;;;;;;;;;;   %%#(((((#,0000,7;;;7;;;;;;;;;;'g"   m !1A"Qaq2#3BRbst$45Cr %&'()*6789:DEFGHIJSTUVWXYZcdefghijuvwxyzt!1Aa2Qq"#r $%&'()*3456789:BCDEFGHIJRSTUVWXYZbcdefghijstuvwxyz ?90XGCL R}E9J4T2UC]?i{™\I$1E*ilmS0up+{- ]MøAOf } *pqr$,!g' 롟kl#sGFF$2/27=tFWs_Mq)7D\νGбԬU f*@|"~!dB\dl[3$;RUH ެr:m,V/TRyT!s*҄l:Rw!)V@Er5QdPQBNvo]X9X5WURTIZs8sR\"*)%krHȮ滦rFW1Jq\&[jT%SN#F +"'j:hVTjRFaJ>T j Tڜ …*]( #;)jU2SA5 x:/ZѲ rj!0 &K⛊,[j uU6y"T,U&&SJ@Hj}\N+4uCn}g=caHƓ4DqR[Qڲ=‘=MpFT Z* 8%Q0KU= v{ dMZrυ"'9^Aʤx+G<~Jt8$`Uj#lSIޜK<C-h֟Y*6>BsQS" q(ǻj>SUYS3By?mjy@00)("H85j\@j7 wyc93<{k/M /k඿K^S'Ƒت;*mY%7>+`2+CKW>2Ua%e_΀s޸aʣ]@Q RK}j+\k6Ɵ=SSM{)ҦF +2TfCVJSw4lU tʛu&F+u] Xlwh8\S&C:JXiRHw,yrAqXIҤgr!qJ9SzVX)4)'cQQDmJ t2`{2) B(u[*|FE7j3^مTڬ#4lwE2UlZS J&F8b CtX`99KcMjȤ0ުJI,I98aˌXo\؝A:hHu[TR419mR$t.M(GU7nu=\%JUz+WbZRv49:vG'wdԩm|Ѧ#8>;b{PfZaC%;5yv.48ϝ4XRKR-ڭ,^GplcU+D6oo#v+}UB&W]:* ¿N|MGM%;o\)/ejBN[*;xUP@"( Aϐ9 h*nj',εlcHJg0ʜe%2!MIl+kL~6HT ڥ+j(|+q"j6i.dCt#LAT4a"UkUMF ^52W` teT CNiQCiw Tj Wt9՜+#i`.u0PpH58b Se233HڞA=5 ԔtQ5WV l2L9Ts$@:r]36$`_-+R&2^v̤ӧpV2JdF$ٛ_-̏nU[|VoksqfbsP+I8/Էjvhea{a'+$[b^( RO!Qپ2 آ38j5K{؊KNUIinNR`ե7=0r>\b3.nVm.q)ӘjQS4E_:al+6 eA"Teʜخ›>9ti ^F; o25w kQSbԽXKF3ΖvږPt̡"QWp6B.7J!g="k2wZ t] +BI85> %L1; ׻5Ցάm بsp aM mr,9)0.! M :QMsI!lͽ\^z9h |;󣰵ք'KoR5ur[LL6T!UBwZ**BLA#i(7N,*6$+*Bc!ޔI'zkNh^HP박pe0S4:R°* r~ږDfO^Q+6#ON⽧5ҹ1D^4qtLWlMHJҺS3]^+tTwiZ|MA!ueRt#"H٘#+\~:l}BN3Ciky"E TQ0KnOyĊj `4D#Ѓ F>ZzG&Bwv cgD2BiBA֨?%OU:;dR N] Vs1!#Wl!d($r°%" 7REvq]Z89\tag 9jQ5BeX. uT ׵T.K\Uk"^\\&i'a\tPy75W.MJF (Tr77$tAL:Ԧ zo 9?7PXGAWneQأNgNHSW(¢đri*71e6`sĝ+2;uڛ7 DžTI4K,M!S6թ{h\5z`c1;uo'>.棿AP^i.S{M9N6ʦ'\=Nfvy=!y;V'q}a_>#Os響."85![gEʍ1 ExF&cWDC IȄŹêKG\Zp@y&5~hﺼL3#/W>cV:z F6oƤƪ{u!)qڣ%O7uZ0@ߨR0ҭ%CEڡN/ Ϫ/;'+a Xm7DÅ8L^U[)Li0hJXٗ*p+wt0[Q CPzUӑRXlrӔR#j5C[K'a*!;vO"Qضz*+[j@E+q/*GDFDv,Жt:d76 ϶%y{{[|OO? D{.-ƴCi;FPIYB!y4BOi*ƅf' c8P/IشMS]K!p^Hߐ0Jmq4"7hD0|o֜|>V7%jE3|Y~:4MbX.- Β#G4Y!vlʬRHn:u= b77A9 McA]{%1$Z= ׊\)IXG#V GX[]"=n9]X1ѷ{bNI1m _q ƚ ^'5c8skǓr].MKFff{+I%!/KġFωU<'#P,%'Sb.ݹM|d킸LF} [ر5BBh<epcJUQj3;K2 ,t]$CA쨲^M'\TYm\,cňV=(C^0ӊYR)Tr߬ vݎi'B L@ |;;{0eF$g*3s#VSEi:v .ؕv>!}#gn#9>4_G 1ŻwVF7>4iX6:ߕ 2P/ː~;<D:8>'}55R$CFb ZdtM߀@Px¬a6qnT|\ʥK6WKItFlT(Y` ?Zd 3 Gצ\$6vJhIe!Z&Bһ<ӑɮUeny'O2zW5 C(E,u5^FK$):ߜY5,]kvzjBY0vNGl6vH]!>BëgCy=|~rQJt;A ь9qlԴQ^a'¤%NU 9Vseە2h‡ْ3O c>qcƟBБ ;ӇBtuڒ|fTFl6FpsHk]+XW |)kzɨ+JtIQjV#Pj+𫔻.SQ r+'4F89 2@ƝTU@;S#`2Tn|)Ӎ.ibLt\dWXH F3rҕE,RTR*WbPrHJJw 6br䒕ytJ)2N)8#25RadD¤( ;(n2M*,wT]75齅o` ?n D1RO|!GFiBj۲:9q`ħ, vf/=1[Ѧ|`mݴmn7}.u` boLVSΌtWnV YMCeS7xCdyPK?~%} =б!U5zF\MBI+v a GY'qp?Bg<JnV6wI F;%2(y5ELn1Hk> a]g:e#qI;٤N+7xL%NO{'= hmdXJujatFH݊9I$vTnǴGh\ӭ&۵Y_%",v,o;X~86{衷XوչĻ$㡧{(vLR` PF@I: *ZOvfh.FQFOiE(Wk& :Ǟ* "w$vx PpFݼ%#mN:T2 3]UJYYH*t;p9xT -,ldW2.py|L/zUg8V9#1&ep7g~0Svm`pN|yTdS ^O.yY!VcVXlq >!=Ƚv,7>3~-+&xRE Id*О%;ݕ.[lߖuGTc/p csIT1Ÿ[&I<`pp;q]ߴT$3!QR8掭P4r4yƹ]œ[ĶvjV4u\ۭ:&_f6/DxB;T9 4p:O[Zzf%s-1!A4nulf%vKaT^TFXۮbp hm;4Sit*, ΝG*ʕ_g12XV@dw *Z] CԠ;,,BEPr=j'eT<,'Ptbq?%{YnMi rUV38rHk(O=ժw]o(hBD5e?<>Um(+pw{g¸7 ~4lْRFڎ}U"[ޕ){sY C a[Y3nYb@8`Ez?!Hr`+}1#يKvZe%nfyůjkb@ =@S/:-W'']WcD \{A#u#'Sɪ =(opz4'E{Lz(aI=fFv-&h]RP:eϤ|>,%td{vLOr%mXWsmgJt 7A[*]7NO . jZS1* ٍfuQy'qmӁwά~1ąƒHսt c`ƅgo=ԌWq\oVIaH"M'RfU"Ii~"ꫵG $*Ө*]#N[9C;?%2XvEH['.B3d#˻>I6v[[>E?vchQSϙ nj6aINdi>;Q$3,GSn~) oULMnKmyҨ`mD1󴀗'Rhn1U\}5mq7js$sՑ*d\ ߒuէŽ74!=U|YI, SZ@aPZtIVkTs@S Ā}QCd}j`-0IDC8\GH7NFA}YiIl)j1@821GڗQiTy&:*)ؤ fi2QW2fxd4e5s3jlD⹨PLJOnReL 6q|Au u>:FkxE\S4A(8^^B{U-MGQ8p0Xs3Ҡ AU^q~ w$ཾfHl1@ i:~(> 46\MI e vՔ`uvޠI"Ą@ %K/xJ`6}1R1@!t'8愈06#7êG;swjG:^Fs19 N*80l6-]~]Vp{V4v cW,g onkn\QAqDbV*Ю/p!kk D2I;l;xf= ʦZ|iN;8\{ɠ;5Rf9ҵF5fM? 7s!XT;1I /H`N,u0:L9;$cXPm)/lMtiMSt:V*Bxmyx2ny)'zѷ Jtj٦I&m`XGJu7`{}xqsq$&.(̏6ʩ Nm-yYfRy_k+bGGּR?E't75koKq)=&B4pp4wJ^!nva=}*׃Opr IQ=Ԑ+h4 vɛ\dU5 >O⬠VQoYsw*, {yVuTi@x /jaDAA!r]HsROԘlyMKZ\%C@Qs^ U&P"܈rj]SZˋv7f4fgD4HLNUH>A:WŻSm#8r;+PO7gI9|q/e9QA (Szini;TDz HroEBχ-^Y)q\NÕ&^"nm/14g$ҞW]v+#$LW~b?@AJճvd65284G g|ǣ?Ry->+';|]Iګxג+A1@Gw|@50o-pUhxsd\Өd45pȣ6W i|i=bÛ0VH:}Ϋ$c,H;f@RIv]uqq,ucEI Y֜ՍwK;k֭`::\ZbGS]>r9+ ui+ ITc 'j9JE?Ƃ<衃MWQY#ӡ7M݇* g[nrrY:WScXa1j0¤6GhJҥFJ|dK~ +/S]-ҐiC^04MuNhPzTmjeH0A ]H0y J Ⱥn+qR4\*:TYx=֔;jSzkr˨t'[!\_i2): ڎiDٹD]=)* O&u%ݒ!]+&8;b1/GxsMGE 8a|dIxuC8S2wP0DNO Deq{ɛw=e5cebSF? *; FnnqDڊ9V=OG{Ǧ;ڛ-"ՏK{@|3~Џ{@lݫκCFNI#,I~tw߼4Ziaـm!˻|衮6Fr6<˟?XR->'aW^z$SXnmx &. Q?rJU .Cr 7<|ǾF"~'#p"2F_'a8VNv-E]ĆPnXe˸ fZVqu'$}& Dr- Z=-Ƹ|ZĖM>+DCY<(ڳJ5l`lIfX.E^zsActtkIYc6b00'o@w$p(Ў/$`2X`{MZQ䫝ρ4k뤛5Ib˨/EMSlYBcZKy<~^2HYƜFVVI&#g6K[Ô ;x5c9QS7Knnܬ.xG~p\n_XW +q70o {ޣI총M`iZSt1Ӱ&=vwS>lkQaUF9U5̯eIo|2$KF{[*p=&E?Kd\)[I5Uk+UѸ"JNYnƣwkl5O*F>BZZ"I*~94~ur’fHh]Mi:{='np`iێ=n2" l߷[7! XOU"=l>NuZs=;n8#%wC5/mV6ގ]5|o`&U 0l)@T;58 i2Ueq`Zct}XmL1)u (^t .%p-wM+Ќy *H~q&t|[ZCuMNlBuV j_mR~񦥺frUZ/3UyF%ث<PKc@UV%e>˰'DžIGQmĈSiX̽rM"8 A }1}npAs]QQp0lʓd3JX([y^t"(F6 &]}&I=:UGhcéV! ws4-FX6ZڮBC8XTHqy15G:"9.>e NHdN e'mc#ƣ81g|ƹTue2.ԲM6`LA.EW6q$UF! T#ϥTFSq8;j@ |I9ifҾe`!P=\u3Nm",QiLr",1bHe-S4\r;Nē;s9軟i@4G:IQ&u#̍ltr-e;Rtj̦Z!sV ]7vxUTq˕0Ȁ^[}U}UR1hz޺J9T0+6H5hxxrj.[IvUP1PmYh#i-G⏖[GcL{9-{4.|z{iDdIw H8:4tOn'7Z#[ vR^*H?uR!fg9qFz}:Έ{ @*}AQ8O3֦:+ByJ(+POw5d5*nySC\0h~.v?R&10.`IbMIK<!Pe)żpUG&~]#V<˫HW4ưS'j?nSL۞y~>9Dޑx,_q*f\ywpUEa](!/R$s3uk"ɤ6;_!7|v-7 ="Q\'m۳Q0Y^S~]Gp~a `TnߋJU#?DB.;Z G؟i,Vr|yiɫoq:V%TcY49Ea[b僚<yWjDj۹O)rL|# DV@P9פr9Rⶺ80+ QQ.v2vt#Ճ]=c^1KY<&ЎkS ӱWj?e-L|1Um-b>cvx4U uOdj.e߲<_=ԁ1Wc)_gm-8(§IsRKΆ`eߒ p{nI%ʏ~KKiq$b@;mJɴ7"pq0Pjxj#:@ұiQ^[ws uj+7us,-{FXZY31Yk"ܟe61|/UŀQ#<*[<$س *:"H-Oq;s,=|xsZ,s䁝l4ۛVxai0_,QF#L*J*`Sq0Y 8#3PeGϥfR3@)1_lb{mi~fǕU~Ŏ#UGĦ4fF¬YV.5hO\۷Eݎ*ᖙV;؇&ď5D~Vܐ;MMSG]Qj]{2vGG*>Ku[LsNGz!v,L|Εm]0F*vuyI;Qj ?y&c՜ĸ72;۹WqCvii+TH8} 1sR)DW1A$dE \\p\W@Rʝo#ǧUIJpL4peO{K%_6t{Sf][ı-5 XP-ک9ȗiݬ)!WCcЯy5I:`V WH~i-M! 4\|m >\H &Imĭly Nys#=m,IkɭϙW-@#S}3]qPkKCoʰ#Q&q ,@ /ѰeVoڝWg*cg:P>dө¯%{5`~=zkDbŬ@-[TT fNy'F=4(5GtIV176%5\ȱ(9*C;wa'Gb]IyѩG>m#C LӃcmMF!|N~2xFW9<&HFTأMBXը8EYqH݀lO c|wո).mۺPJx뢻?sΨ8H|9 /)#ԗuN셁63ȱ xTOg$/ &Aٮ ][=!P?DvP|i0G[3o*Z@*(Lӝ!n-O>Ա>MbA`r ٲ̞01pIA g?qMD#cD bz Vn|ƫ4*8yo\ -oks;ǝv%5άls"r]0\Dz^AW@N}*ĿD:Tou5k (f'ԠЊPӾ KSLN.M4W450Ɵ3RH**4Qjdq;bRTtL"p{joGoNn8u>(/!\/C¸|\uǿinheR!*o\H0@GF|V*GpY^ne#?"Nұ$'Y~[ML$8Sl,GX0Հ\OmiT1rƾEQْڈ3eKn)4sְ㤚+oͲTD_ȥ qLG8m~h^OhݙȹXfND6zrIk"w5Y5JN)줁 :ʮuTg'mZz~xƒU$##;ᗝ]B dvH$c¯۠WDzHy04υ~i,D} #ON BQBڻ.*dž޷yFXSaݬ+jj#h~#ؿf۩>/m\YiLQ;=0T#܃L`)D!lqlh6_N33FUDo6w%'OXJx^Z::TB<GNrb%';eYm`,7A59CvVތPc>ӏVv);=35/QPXm6jF`aJJ%tJ YB+$2HpI=J^(+ &9GTko0^U6&E6727 ӷKxbTM1T939-AvjkHv \:ANnP|mMj7p-[p8T3{w, H1fI늖n)nP,q d_>o<?M'x0ܒ\㚩 ;n"!RU#=y,oG2*TdW渓 j1hh—DIZ:X\S2Z*jDv>8оԡ1rsS`k:§Pyt'bGj*T|2mh.t8 -s\]dNRm֫zmk<:xjŻSVհn.1 ­S!1S W1!v8L1(Ҡv8*FyFCvhk2 An5<e=5ah˕ ~5a -&Uۚ4HҺaqOB܀h6bTv<1=S9qέ.^FȁԜyEV## fH]Π ? q09 |ZP\CsL XO.wԬ컜n_ }uօTFpG&?/ATU4)($g^16;gvJdsκ H1ӍբP"BCoΣ ~(9cV"E24d#Se.JsΤ6U^4VE 4JAO"R,RW\I7wr XKɟ|`T kSTrT5teU*PyV\дW</{gK)^Fg=*Eڞĺh~G2)*5)koÝCtx8ƬIeV#":2-sDpay#IcҌ厐Fq$1F̥W#XU!湖Wuțqf%"f{3":'}ZxTM=dkR.vitO IRH`$ZJv[z.4 ?3ucA;N׊ϢeYY+6$ hTWVۊ[%<&F-aqqv䋻/@;wφF|Mwgn CgTN;{Iȇ+)#Kg\+8pspfJO4}XLHD@P;|pkeۏ٨\qJ&[7}hKJ[C? 6m!\jd}XrMf83lj; DfXQ }#Oi T^˂qg7ΧOz?XV^Ŏ n@9×21=xæ3W{vanj~ E8uVQ\.F*`4VB{ҝ?'*5ƖXs,GT'sKFA4B%W^!h1-SX 3}n.mʁ\>#{02єc[2UoqÐ:Gyl{LJ Hyqo fPt5m<7jd=}%csAi-6^`iA%8h#KeXPj ΂a([!R-Jwk%ĈhJ;-5[( D ^m&9I'J{;1ȡG pH,N0$&I64tTn ,VVݚ(N6>i"}QXA'njt2_<_ow:\)^)coi4<9o%^Eamω}v F6a8؃O*!N *Up8`d?b;{*J$qF [A XZqM2)8!M:=?T#ySHb$xxSTTx2ؖVLkZ5QwG}Sh60^Dp9'sOښL1bK "/ƙi27K:R-2P0u K+S%`:mQrv"D+N"݉<a T85駗 u,U:9-&#"ڂ5#O:!C; G=HӎX''OuQTjI"…@g̓F#:בzm~Rc <+H^^g=M6LG?R(s-VR1*B凨w"bB:XBڐ #qpAat)%ϙx=8'8FJ7nBseQ5gmy@l[ҭ(х0/AuRn50 B|ޟ R:VR]w@] I4Zm*%t& M<=(_ӣSں1I6^"^? 4AL"$&,.v)ǝBcv<:f~4,cY>q6,n巂FE: J8/PseŽ:> {纂WOXRV)6[sp\AZyⷈq"z U1L YQ#dm1UM䖉fۉ\ n)mu>hǖ!PI}!F:IȀTY]M$6R]QIh +H(g}EhHaR`Ffv4/xImQ`]B1\M~9ފZgdDd1PT~:ފEkaV-*{5TUH< Kv\:. E%?C!̱ġV'IP9 ZLJ) qab1N>;?vs0}YD"Tk]Koc zPN5,dh@F.`2FڝY(4\L4r؎g305,:+,;geߚᳳ%(L`i*v_IZ?ѐNUK\<0S0W.~8c=_\њi=,N27i\Ø3M:WsM`XdOz?I ihLsU Ͻ'H3\Y@P|:U k kU,elN69p(6BL.ilL, &Qn Qvcք>e=r>ጇ _nkNde$FFD`Y{k%ܶx\#.}s>0PcUGȡE4.;Gg05q&\Z7>IC%Ag? W',;~QXC}#L խ#Ў.nV2D~.|W76TުKn:[IԹɲjg/SKS6)he[l`ZmrQBޑDa@:# 9 _]XwIWPqPuXn&,Ѷ0F6u 0̆x*֗fɂ ɋP<7q2`r_'[NG`At41E.U#޼dZb{#usrOG5oa8mQi `x3d |`8th^!pX|.oJ,іդ=^;$TgjDa:QKuubk=K4zm kZiߔ;ȶzF57)l-34թl1ٹx K^h%eF.ITB=U" ;&#D0XAq(?L{sR@pWK}ex֑`2` .Tz(cb5<D"F5^׊SWj. L:R^d-} .0'"+\$TfueV\|ɀGh6XzITe{qcScTe ǝr+8G%>` bH\ JNiuS_p:5Ê򁜝yPa}Up9TJ)uqO"ֺL*lTy`<BscPZת`!ug8`=j5ĺJs1cm݊Va *iɗN1~D{۟>UTcLM&|Y N,<0uj<$eK482 yp6|c#F Ń1UƓdFJe]j$aG˵\+h2Ḿ,a*10m.$)Ҋ|,%,/55彾5w_IM:N*xUy[(bI>+\%QUzoL@9TB|*FZ(WHNWƨxğ J.o0&sL4kFu;|%\1MiIy0*9R-rrb$2O ('zmunB`^%{pY;zK_/A^kW kU ~CΈC,n2@1nqb~5JMBE&JrBo%JwG¸ބۋ.nÄYuIU9@GZߴ0k> uCnXYEu}|c`U jldːm+s Ң"[3J!p{9b.Uw/+I=ܩ[`o<*KVlx*gD9^!x]1 Fq*zæͅb-4K0C '}yuAoh#vFy8Y݀Tޏp+JfFg=rzGž2Z\ja2V%* N9R$9JO~!w84d6Zg2w:X6 itڲ"qN/?έc`Rjo7P}#ZK^ =C ,rye[z+x{TaB$|dqU$qU~hIC?Q>*Tg V@"Q!j^C (iU%|fd}-둆b@I"pƊ LC+bRv :#jq|b7k Y00{o6լw3˞}(P_{YςaG5colm&﷿4SH@N m(r ;0ӁS"rCbXQ\4fm!Yw 11S(FPx(R'=μ뢒jax uEp-,UT%( qQ% 8Z%0 xgHMi_3BO6}LwYJbiIK:5M6–FE4v9I $8grr,69ՕR Yޔ̢Y|$ wXw!)9C \HIս;/ZEcg:q)f9".+\GEbS JBGyGkݳ yLbM"|\TqER[ww5dEVhcOtczFHP7?w]G%H9FUm vNO]OJ$ ">D{0zy%*H#Ju7 +}ZMOukj3u4p}R+,ѸŤ<6S{HVʜv{nbz+{ W߆|4[I.M߆Y߭ܬUc  F6U7*ݷ@;;e-˴Oc X+%Fᾓw}H> mi@<ͽ$xH-G+&H##`0CB|XD*IӶ c;';O]VX8NYzt5Q4ٹP8RHɳCOs/#&xd1LPF.8h5w捭)V-`{ ׅ*K;FTGlѩR֖xylsβ8QmGt9;O1}7*N|1❰4[*@ܑ\qimlr˘R6imʼn8 ahc w/uGТ !⪰YGTtd:ILqߑJUmZOkhOqFyZtff:,:.lPl_\]I$)r= V6[c vcc)8@\Na 31߱~"pD"\$jc$\<5 %MJƃ \(zo^z0nuTF8Ks'H*_|(7X{vkASdf[.h[2UٴO]"Ђ)H"+] e)E,REq-+9B TOǭ+l5;/!V4FQs΀B}F_'A^Pqz7U $ovgcqIʓYDcͭ{0 A0jXۤQ]ЫҸx9Q`S:l)R7ڢoe/`:c˭W\qD&o;@R\nr ø1+rFsmSYd&zf-IDb7!J ¬Jz'anEd #T/GI#˓|^L!,c0f'66 Pc\E7b4f[mjj ٚvܖF21dlr65-.Q*"Hxx&6]pZgIIrr9ߝP-4rVR fK) A r'oIox7YKZ8ˁ#0DW溸QٵFeT~5e76M(>0tFmZCH3a*fC7"j1XrA4m&AԸ3fVR0as8Uʈ<(yʁ^g=t<֠RBS>&YG֪NkNvj;-^Қt"*fFk[7LJGhJ!\T5q-ua(ĶRʕҬ {\fATk>GᩆxiCPy4a{f̻e5'Nj7ͮ^+}.Fcv/ng$1>>Mm- g`>S=0LJt{5ziJ59QsL73v6vM*EB9 R^Aï:;f6Hscx{|3t80d30ٴuM/;W@VZXx;G,H<!ukEk{VϥH{Htw+$*=GS:[Y*QE8 -FېhM:#޾{A=+uXcHy,j} . ijCz D2II4'p}TKd"x>ԨI1]&ɽ,6 3NsB*N񵕗(ըX4Ha&'dGh3>@BHSu7gbI)?N5SS@JV??X} սo=4i UI؛A@G#c `ƌi4:UI=)MLd8'qQ*:CbQQٹ`xRE=\W*cE7ƴGP2960k?CTA}&CH>)yR٪ͧe|tlWeTs?N(u 9 'l޿%g7-78B+/2%So)%.43i U pb#4:֛ϮE.қ [eƓ{*KS>]$V M2[pJ:9HTUQڭ' U.pF{VX:Did;]bEX'^$}MFld g0Z!13jydqBx[~)58IԮ3xgz"Æq9o%*d333N]su#M3SqSx Z%}Ñȴ@~)6n: C:2)*q{Eܬ+vi]"4^D@JPZY@ڹ\!$+KS]ϟ?Z8uyA8'$lU Q#*XzKػFOoh.f1lzb RJ nbFw)1 j?yEm=cnQi7e\HfR"x:%`x 5S**:PmwnCsDXN+{.%(#t0IΆǣ ~-Uu7?i/R׵(nV|jȒn.ML~-żM$zTfV\Mv.vli ڷvs'-U%FTѹtFTxS>4m=*Tƶ;zi\ҥA*jCĪj8M#I#j$ .lb ډx5vڠfv#Rmf4jqs5@.G'UU xW\H= *Yb=J> $ʚ9ՂJqEAk0i*yl6t#\;veќn=U(ˬ|am@i;TzUCOF$qHH~(PŸ,r:d8m313Rl`e'ƻr8=}u1Jfo\`c\u`x.j(ޛ| 5r3'p 31[#cRω JᆹrpH@ޝKQ # *|}kpcKXucƹrB؍E3>3W~lzr\G@@WOucQf|5l"TXԎY\<NVH]7Xl[sDtCcПT,zvXZH$|s.E*CnyW{49 s ŏ pI&jW&P\㨫u_eGɤ$.B V6иLJ pI! VjAOFF x,"GB.[pyfcڷn¸,YHF v ^tYVj20 vy.VB&U `;ޠ*K.A7?W"³k}$+4I}*]L!q1ҹrjJS_k$aEh+ª"*Ғ1SoE KkkmpW+p\W%ґAQ*gWYO\xUp5x\ihV!PcfԂP Wv嬲Mh&%aiL}J>ᩋ6#U~2%˘9qQVP9S֤ޠ„.>Zn!-ݛ"kSH5{u v;]#DNg-ٌrI]^t<^DڏOUDhĖ9oLۀp|3ROQoUe,p7ˋÆn Iϲ \rQ v_*fWgâ[ryi1r}g&B:I\c1)P׏]wId 'O/⭮Ԑ'hm㤨ů7*~w >.Q^ҫTˏGuǨQVck,/Wmoزֿ;+qrV;?cW\^9mf9NJΝ3X-a߶fO4o $-oSQm=k) S# h$Ըo9P4 ҥJDeӀrwonCi$pFW2J)8\Dw=;dm&7ץ҂I<)hҢ DwP}PQtn|q80p.xR61VIDmRI#rlyr95n4 2Pq n.4x ҈ !<=TC7(㵓1Ra]8'%'5srΠG;U䙾Rq.)Lf$J'.0ý.F r7Mln5kPn۔'ǝTE5sTqr|׿p/۳`"y( ::ׅZrXx'JvaU>qσC$=$xmJo{?W1m-GCCN$y;!o֮vLJ+N9f/;ήQː\ w]:`G!"Dpw̪Ke#K1«cn-VxiFmΡrP4=vER29 ~$4 N+%@BAgj H.P>˵Ɯ RbU!DԘ$*G!&3}ԝY%hPQ@"epiR 9 3ֆMֺC4̬v`&.5cZ_`Sph'A7gx0I< {ȫw(&2~j>\.FZ]{ojNHdPo5 vܓct%:@?P"re/dJUp6eDƹu]q&M9+PD}LQN; i'7_DAΜ ~q*e۞=U,!sonM['X` M0#Q7Mr_Ǹ@u<˾35Eo DߛoR]m#?{ǭY דgwF>Bh[l j]E<&7kxlbvЉ$c.vS{!BU.r\T ;,3c`suF vբ+6Q%VAHzB&>RxSf JH41ПnTȷփEd>2Ơġ,gnVːC?!~Χ *ˌpf̖eG7Ȏ+)r1\]'B34#899DCQWY«nH߮ke+(+}ZRܨU.zRrI W: 'vP8g- EiHʴ"mW2! UNU|+!M5Ϭ\)w;q)KoSb3\9#t#094n5 C})z:)p-9>ʸU*PX\qUzwNRWnirqS9;9rҝS쮜 Bם8t] {{+G w-w*W/<ZZx|)P.WtKTeIB(ɚʐ!pF2fJ4k.9%H` /E՟bHƭ RHVƓ̎ʂ&fU}3-1t,c[; % 3mOyiRPV,m' sNeVI;Ƞe=*Ba@PPif}ƴRyp+~.673H%"c'<"k9F9 [6|Aҿ-j\F.ҕ ow9,ب>UCܻ(E` oryfÖMTlpFG!$w.:"*#?Cv|֡^'v!WG 0 *ʊ]vfr΀ߩ 1ܜ͹ˠ*cHQ*4?sX (x8P+ɥ%ٽUi#Vf_a4'(O.ڬW.WPF 7UBP~k[O!Vݤ'G/T[Ʒ`_x\mo ]\Z@خ 9SV ]OL~r3IAfW8X-j;@9LJAzKısxD$A\X-sv!A;]#Ƭg +;gkrUKd+||>rs#Ǻ\"[ߵv8®?.۶,˥r*}BNoR2NK(4mRD~uᚐk|Ss BT*Ndyf׆x(#qN$c6˅a6"q(8+>N՞psUAo^NhA 3R0=9U 2Tp-UCvvQ8b}u(%춁#8 2yU]ąȱ&m1̵ Jja@ J=jj"@yNĪ9?RKΛn)_ X{K}mFb?Kl~JG!/^s6ϋgٚkҋƸo{D۷՟doqB[ܱ ^\o$:03l$%wW.VV+$)}n>QRsGkJFT:+g!r㗷_8$3\F~> d^D jY[lrjp8DV9\BlI,X q7L +':uj嶊k[wͦUd!;˭~p!ըeg<ZwFV㑵s8'J5)k- NA#e \:!UD(kk`Rys<3 tZt d[Vdz*μOiU̱"Cc~{懽&dk{Y!^Ʊp΋Lj\asFZ%Ig{eTe9IꉀN{@%r$(Յ; Dx~?g C3Ìy"yI8w D rPTt!&RdI%>#~;༇Xf>4{.;{!7lZXj,cRALe7"RjōCskt # FGnH 3V+)^B Nײȭ+;c3Jq+ A۽0* N@ZWgԉ4m2S-m&Sd%A{g6'jöӦ J}s >~ BTF\,u)b>@\20$0B h,18Fe4mc $vrgDҠn6&xfkQf35x|GK Y\0NygjܜBB@㱁~$"QH;ON%89(#WԮ\!K^ rFXP2A߮✃=ژc?T^zG'jbܸX61,5t0Ew\ ֺep+>*ecs%1> fU"E*\lc sˑcl̂>wENa:&*: pFO^^"i>Ϲ\G~0=i}ee*O1 +*0q0d\=(裹]oUQu6;:$կ(pKJHd1)\SKc6}ZI\0(ډb3(39(sK2-PӪPE,B: IbQ[*qkE ˈ;;SH$7cR̷)HI|7-Sd 6"HI@ v_x}Ż@|+ߟ׫()OgtZWVHS[ɘ (~R9蔿5<^2|hM hxIM[z*x%:!s[Ż X0X: &@YBYn\#xG1op-m򑚗<@N:}r ǵ@vݗ${[Z]xE  #¢áq1#3IQ}!{8 G2 crcpdMy7UMH6#o*}0UR Vq˓K ^p<>Vi*@Tr}j/~M딪|q"1~-UM`IwEtӨ}NZ ?Z)DVرmU>@Aa]e*W*YTcHkxzyAάmy3ZR@LO4 \1ιrHʠ]^9=S#3fƓ6nT.PbuO<}4J2H9~r۠aQ5S85 {5t()~\ЦR\g~~Ol>>+ֺN%9dXMSJX(;>' F^5!1KwH5&"av9ld:6n-dDYeץZC$ޡQCos-f0Yf0TȞBZ (I$Rq#nd{-q&/kTE@ҡ˞d=x]H2;Ҋ\GqRL '"7eytFWC[ uZ0Bz3򧍺uF #:{1Տ,w*gDXCHv8@Kn3' 1:C)(G |ThQ$9#WUN>.1w/:{7,;h;iT`u9#*Ã;P\ܩ:/=.͐u:"ois XK$%$ܘ$%u90M6X-+>į*$Ԏ(he@7AZ"m(x!33:z e!0Gk.LىJPAA- hv*&FcNwڤUD[*|gZLo13~"nXby튿d?aqn'FS0#?;g|k4f~x.`Ԗ!2׾ȩ `:fdEKurP

unTeemi6%Q$ i4' ix38\Xw[eS*.IR#j]w#.="E\ m)]PXp$gѴ?NHH ],r*ee1%'*UUv%uD;(AL2'jݦu8z\G\c:Tq]He8RIA[#OS38d?1Kvg=:U͵ $}(-3I8p7Zz-RDf263jI5L84( j#n6;o7SXbB%udoG˹5s/BNRApiϮq# ۖ^.1sdo  2&F+FD:fjH*P?N A{_}]T}G![JҮ tVH8 ] k(uPʌ zV_]v֑|&rUV-B1q`\=tpiAC@ꈉG =ZdSY/w?"si!;nAC5&͕S@T+B3b4|) .skinIJgĉz"IGsl*PQIxiQ1eԨUXQʓ-vexjS-:҂yD݂;nk:»$0aEv|AVqH#9t9f8&Q)4Ɵ x9H¶z}V27RA5IDӨa}'f2L噰yϫ ] ZK܃HN1gaL:\yv>gڣ6$큍Վg˶UT0ue*i K *yb ^bѠ9#@[A@ \G9 1*: oNdl'J'rk[ ȫT$UPEm ys*R*<ٽ=k v9yUuĨ$XGR- '%uh"L.Gf1JA+ж6Ͼrj50s;ˁʖ7\`oRA@ ,'~CJ6^fJs`gƔ;RRH\ڙbrª 5 g|s5 y,SyT3-W@Sf& ՗/שZ`DhVd^EtXN l +F\aL :6"{qqwiqNq>GXO47 !ab~d3(*$tAS"*gmJXH *$=3WI%E"D3q2i1 GwyB)b L`r <0[|&&qopRd(l`n1S /hDlRef'$.χ-چ7L,rwbPuv>oFeQ Kݓw T+9"2OnLa$fpB`30Ökr\;}9 # 6kieRZ5ՔQ7s'yxkhs T*K Nߘbf[n$$#6p52q!3Yⶈyr42`YW\eTXqM̌t+á:,yTm{hfg f u9L'2;eYV'"Wù'c6RB/5YAbZ9Am\l: sKks :xV<¸td =wW$sH ";e۩^দ$)b6QxK۔r_yrHhLI:*3}^",NC9*r07V؝viFEޑ.~d$QqqSG rR>20,`~? xm`$QytcGXm;;x8 O 5N7|Īfܦ1sbORL3>H||jmc$0Jʠ9N`9r*J2ąR;ah+X t4i;G.G M{ {U3ϳA*R3T(-0jQI4m9>g#52dl7s\k6W*x>*Um#yy,$2*S܏ -;$ {+ze-ʪm6\V&p{qj؝Lh#.| P1#fdVPOALĐ;8>\[[bfkI8CoROab8Ԙ;Y4H:#6'@\NTɫVN['p*.Cx(۟:*H8ry ]Ϝfh39rMe#Cq8#<<5;nٝ<:Y~;\]\0IE83RDm|)nFT [5`殭r|}]Z+.qAs\pN$.?u8u^U\RlA#brZH*IcqϖO;A gTUcbHY] \U myd+=N0 V%튪\XsVA4C=CTy>C=7=Bϸ(Tgiqp;\ɪV=NTDY 2ajK,j ҼmPYO*ljr[XM rom[ںrs\FgeڈI?? Sͥ m:}Z-g*=`!!p9mtsUpPeRE•$,;oJ zk(P!L'RDלr4Sy_>wk^СIl)Dj:&@tJssISXGʶR4AՀlލq3f-'̲HcbdP,Ԁ:M_pY3/xx"0`UJK\6,VghN @tQ̜FX,x"XUPQ{G8Fcm3Ξ|4[hgHRflHʤz/Rjl Gk/Fi8˻|!\Jx|t4MHS2l<_P%x"1P3w\"LJVbX qF $̀Ak\aHh* 2c?0"c,[A˜8cKYKۣ9d"D1u 0ǝƳ(|ӆpPvAkH݅N#trŘc`nFV# cλ dž75,o*9HdLQ1'5O2Lu0m󇭵)<=`nAW(P'[;&0) A"Ŷ>,(b9IW~6X^}l@U%yy&ILԮW6lPK.@y:nn3*N1pI&dnq{ڬks gO]BI瞋߯T%x9Ҡm#!zwU64 XcNzjލZ: y;ACz,[iZCڻs Uq|uB$zxT ,oabixVE2:gKP1#*z-XvDSf1ƈxf=41 ΖS2 lq} &ٌLK( G|G^ĭNCc ^=+[!ndḿ[FUex82&K֣ kw cP(b@]ZKO &6.P :Ϙd]HG. @VA|frԸW[Ȅn>iKK9ܰ_#H9p'[` ZEwVQ=*Y牚+N9V_3UW'K! a2ڱוYDRI;YQw91C֩d|< De^i7vn@v˕ bB|]vj_IXMs JK$+(]ô56 @!`X*%y.LR4՝$$`7d@)gP˕3/qU4dG;5)٩j,Eri]6ΘHH8!!rI.'޹J᰾БsVuhmϭMG\Ji9RQ}Y`JXbֻ+Ht7!Jd9r٧T=rsRКd@R˜i=sj4A@d!˕gs4ѷ>P'1cչflsߝD)n 9*b7<gf2ڇ4"ֻDL| d,2̜ "1Fl`B@}^ *4ksur%&>g8{ƥG7 Ԣ[~Ѳbyw |шjÎ45'|Rd<:Pq쥱<[$xt\۔-0\c$0PN9l»,tʂkU%L"K# J]v֨;t*6?EZ#!T]@sU\6xu%N.b XU" .YϧV\_ѾKįv3 ߅U\5}!rωO4.Rpdv@:U.&T;\`vEߩm: 鱷UR=pASJ hSaiB3EWMb?MpdFXim V727ဦs%m=p5jEů1"eļFT<@C1QY0 \]+qî-_Cíj5 5coz-_](Ka視AR)^=ɦ&% ޛHFrqswwy5zLccR'ս74 II @zdCO _Y(ȣn9>NX͇s)VPp%R=VvR؂;ɟ<}tߣp>lOfΆN+VE'aP{lu\[{٩Hj E`l)6ĸN]jwv$|K}˚&Qۚ4E)_CYm,wBXG ݊rFN* *peD3"&7~װA;ylIzRo s/e>a_*T}S.3Q![[v%1ݜT2NL`Kdi0yAwp9eW?LG?oWTN#'i8&/|QQG'٦ F̜RodNl}*^=\&Y܅LNpqB1oxkbu‰%TdΉxsp|,HnRXt*.8xHQݢbϬ((>7ADG[)Y8ڹrc*E$Üs4A$ t9*Z$ ϷTQPqќt=8g+i:~gA[:Fw5XVVβ'2 z&AlpNq.N%Qsڌ8e %@ !9?*WHDWqCuai23 o@*.:ƻ##=* _RZFڙoSM~xe|O~&0mc`۝ǟJo᳒we AuB& * ;{%Ȍ.G*RK*8^ *K\ IDžCHc<9q.r=r..rGqd P}qE(szG__lW.m%?&*,ޘpXyˆ U$xԎ=9' Q׻$q Ubw>4GT8s\0WYr9c+S8.VSzoӴYdh21)brwsWpu; 4&7'ƞhd3ݐ"bng\ܻ7lG.Oyr5'n]"2kҡ}-nEeom*9dr+R$([̚o"4P6J<#!zY!Ĝ"aR6}snQ]G2Iy kPR!Ew7K")X7#o?/$rdA*G#c*!|+qG7GF \9@*k5)8lc9K* 0>fN91ft_Im݌ ;e|]k;8-RNSmM"k4fk;=$=NEual!XDZlP\,} ݯ&D #g~}۹.^LANJx_w  c.!MaHIʜWsd_%s]gsu ֓%$g\98NN;|l;u/2yۅ 'gF3GU> S/9u6eH0t}dbcpI!oXAƙeQ+wt8.dOPYYU>3bTo/?eE0M*W+;fRz,Ue #/_WB{Gw}\ιB򇔻=6cuk 1>}U\6ND(MZ  h\u nî<*)?a!fJFB.6oPqK$)3 V:T˨5߾Db`- v 9d~꨸kˇwp0@l+)pu , i'';%'6VVcک}ujcΥe,q|"X*\s Q۪iP|-bTrF!B6^w3$L _chbf[:~7N[ -01>q .(@ 妒Vʿ Syg~ Qˑ!qR5D]]nW4peE13HZ%;^(}JU hif`7jzo1o}l* $_E_MGuHEAβ1&q'"RD =܊HSV2*HL|JЁT8g6wAeLawZ8;pH1THF9jG1U(DYPn x[(`XT /Y[)ydp *'Qץ !49A^ h7.$$L( _Ax;'Dg@qG][HwՈĪ .d`iȌt6ME}ébӨe8&y荧A$t05zЍעW꼽%+!'&# 2Dgn$ca [{.ҧphr*:dT)].XFB d8+.|gp1Dz}R@ Վ|7r0Of\"K&u(ۗr^jlߕJ&Hp9 ¥EfUeJd :ׂ|*|͹Z܆jҪ\5G]?I4F2Q*Xf||ҹ$5`cAl0X¢K@8Q2ondFJ` ʹJfdm(oƞA*NJUa%TO8^]GZeWbi%jāXw4*1Ml C;Q@T%Z|)Fyp9sqY!ϝvQ$C̺wKq>ٜIVBTS*`w<)IL* (\<{ ao/HxQWӟhx)G(ZBS:P՞orJ]]$NDrfU$ræ|IGkـ(8uH8;i\$!l^kLHB z#&Bl(d0 G$p$og3MvQ`[9Fq-ZXl(gl 8Q!l亃mQKX(&X1YN[;.T9 ul$-U#ϧJ.'~īTWecejkqv\M|rak2D$0:mʹrbkY&b@̭XNASe<0CFI;q}$[+N{Ǖr"[HA؜zx&LJ  ՘UGB{62b9Dq[)sVU'8܂~HzW;KV4.`"T_"hfQsލX+Djf%ѻ+>./D(2{^v\dܩݎ7yRP 7ڭu:Ku݆ 0rG22sִvhҬR1URX"NE-$M$9yTV9m`iH@|yocue$jUZK{ zi`f.)[W `TY.1Lv7[VTscM,yl .yIeuauT<>Sg4ZL퐼OVH1UR0ۃczzdUż"*yU\'tΑtpjkݧUYW'WN7EbL9R4ιrA(8%(sZFye 6XO*rj7J{N@ q&A?'Zx[Vr-(K?izpN5nr B77e1u//*dUCU'@;Roo%8 ً1Q:Z\*6=*, ,7>ڃ#^}*<@cq^2M+g'6*3\$s̺Tq6.SFI9LK3 ߥBD6קa)?)4<)WzfbHB ӎzau :aK8#Jo®fLIQQ8ύIkFZ3۲&llA>}*@ȺrSRAH4fsϺMV[`/lg.[O Qi9:KIʜ 7ۤ$|SKP9,+$p.[t9e~}60۹X7#r$™T`2vq!PN;fhuPNHFu|Ryef3CBjI܂6 bsEmrV9+,9<5+e-F'mfeh^{#U,FFA9—nꋕjoٱS$rcx#$>x[8C1UH.]I!,69J!RZ]X.Xu5+qjilZBz$4նlV3ni\Q CҠC~7wm$ GW>{ oO,g0H3QrXA,-4f*qbJ˨a> ǹC.;H؍*;1,Fu$xxcvu(l`;m|* HbN2)';}z\^$h7l UJBʡ!7\` DžKzMOnoʦ֫#%r]#+I{i/*K)5#FӨ G& b(^Y0tQj%223oȶBKc8$zIwyLy,SX\6FlS~USNP #=$Յ ܣ*J[OB>^i ̎#Eґ?}EB=zdx̌9qQ FrNvʻ `-ѣM`w 9 '=у5{ Z[L@ٙv$(<%A’A89vgLZN>\π^!e2͐6 1 c|zHw.'Z G|RFԑ ØWvs`I|ILļ *Uy3Fv`s}Gei/.v}#75- CÊ9?B)2ۣ3\ʊ%zEI%. gef˶HT^J%yy*]דfEкBf2Y {UV"2'VS$w4e @ʣ#C.5m Ap"AkKER.8dlNub@MhDۖM3'[n>.nU_՟k'6hL]rw vO(>mo.FM8۰R. [cdYBrYV;]J} =`A#C:Iv&4ucHr/mQf.FULo0B쑻G0@=Rvl׭qEM2,*'"CUܜ۰2u)`c$5wu7{%N%ABw@\>uB &2MfA'K9oko!Xdq.sV({+um @q) 9N7$ڸE5IdXCu6tF,vaCrӷwi?|ķ9ɖ'*It5"k^y yoT' ;Q: x] ΕTHWlo.5[Dó:c56b2|i O`Rv#8;vJJڗ 1`v9bEbڲ -ϳ#Nvc.7g9=9_,j+4 `[tBCnAp>_U8Ifg'\oS C'TdN@i,QQAN*OºJQ.2qϞn88X;n7 W!f=XigIc'q9W^1C< u8as#΢6^FSIՅa*W:յTh0v'>^vRIHF{@9Q("?J3Nt.ol<|锳1\H)'>o:y 2۬Ѩ:) vק$ +Nmv\"vj9'pq@|J]* .c2Hsc`=p%X+ذ܁㲖S2:fy 9? W{Ys2#b[9]T(J4l2Ss?Hb!W(ϖ/B{QtPBUl{iEmWri28'^⁷0*aDcSlj8*rΗtە;wyƒoUTwRYrBwr=CƼ#ջ0cu}aV O#[ȸ5Bѡi iΑ:X/3і]jT 00FN+ࢉ^VH 5=uF csv{n4Պ!ݱs; Hk[p) FNI8s7!k Þ#M1C|@* H]Ȩ.c/ z{sTF6;l~3#'*4ɂcLf` beeloƜ+tMh@1}twH[a#Jm&"HUK),a.O0I-Ǎ;eG[-L Xπ'_%F2w Fv'oȜ] N/iFTtX g֦b{EJF]¢p38z8 `v?)'uDflIrw $PUhQ*{R/#HY6@%F"+€R7g& 8ߗ:4҈Q̛(h8=۷d2hd.bD0 .%.n'B{4vf ͱ-%H}cΝQ w$e3)101.-o:1]\8p%b#8e].Bl2>Jb- tY/$n;sT) l1>9>hA8$a2N?VQ-츀1;NNAk"X84"!У$od6" tО͘3NF?/MA*DJ3DXI)7 w k` Jev PcO'W_Aj1icݨ/JX|5ԢEUНNr[zχ͡aS*rPiV6-S?'L_b?E_/nV5/8}C\vW2 屁Vw 6F2YPv@Inyk'}UiɘSJm9&SEp5dq֝8U #3%ٲK1>wu0ԫIR VK mmDk+J_28]@jm ӈ JhdMLq_-]~k\JQİF!fWnkA4 tPP4#*}WOIړzrrrFP9dM۞#ո司FBE\ m=AJ1&6 +*E~^ܚ٩1 rX1Pv+FqN)0F@ C,'M}|CֿfG樛TčtUJ[4Y9ҢRJ4`j\v>?oZ&zD\QpIJ$f/֡ɝRje?H5dr2I)DF n R!iȿReb*^[i<@8G"9eAH,b$gTH/ҥG?VԜZIH XbcI:0v&0Sш(a'd l)/ۯ#e*cPARl)eHmaFӒQ፷B$Ć:N3| R5\dr/WĿ%I'v%׋M;aA*O{I$Kard$.G|/Λ'.X>s~0\W8P!Hm 7wR4H&6E 3P_\VQSy]U;E*P5֠|a˯<+icEv:xخX7?KWcT2T>ͲZ,,m#\RfF`9J9*=բan̫El<NOS֧Z~]2>/R URV#upo (-4I>/Oiܵyk-\RJJw[;dKo[O mbЅbFu ls]mS@j_c|(JVq2΅w TXJ\#2 &2a|j\~}B~C1wSn8.C"  #CR`KzUuJǐ<=[AOʴZ6$bY]! # [nX'gYdY#S#;ok\~R.)`ѪC9E'W n|*]zHrF 犯aob}UϮ?쥮uβ=YeP:nq/w*# o#9fy//IoUmX16 clwIUɘx>Z}?ƽq~FBuʫngl_bTU~7\ endstream endobj 1167 0 obj <>/ExtGState<>/ProcSet[/PDF/ImageC]/XObject<>>>/Subtype/Form>>stream H,;@ ާ ı_ D M@SiVM2I:|B+_"$an;5jf[xԎmZvZwzP\Đ"G!Jŋ6/"t endstream endobj 1168 0 obj <> endobj 1169 0 obj [0.0 0.0 0.0] endobj 1170 0 obj <> endobj 1171 0 obj <>stream AdobedC     '$''''$25552;;;;;;;;;;o x s!1A2Qa" #$%&'()*3456789:BCDEFGHIJRSTUVWXYZbcdefghijqrstuvwxyz?ЕѕҕӕԕՕ֕bm&ӗD\`c&M 62 0;6a&Mˌ%(sRhqc&MqKMq`c&MI1D˝&ӗYMsa&£a&\ld˘\96%ו;SN/Yu>&u9 KƧƧH֋ΧڛΧ}gpUcSUcSpur íWOwION7yOEgSNOr| KƧ«ƧXMgSgpXL>3fE/EYOpZ]f5\u>&u9 KƧi|*@ЕLbR]nSVL3gshs^I͡d"s1v>bt>rt=|5jdlLh}$Nj;%LF&Lj|wt=62gSefu>h'$\hxm~*3'LΆF3FI͡ڬCxXjct|iN:,3ɳ\8x*)&Q3f=iaW[S6pnEc2UNwe,3#FM6b4<\'N %$ishxr^&N:[<%c0OB8jym2fҜ8zlV99$^2^9i3oa4̼SѕYSc3f p]1ȻSS/-Lb7ϙ㋔l2W;N{ aLFn;K3;l圝z>3fdlnh}jˆxci.UZO3)aqޘM2\41>7,dh{lnN)]s0X刺'vUFfՓ|M1 NRE19s0)رFbZRRglL0ghKʚeGl> f6OU:[^ꘙc귚ep/=Pͥ(o/]3Tgl:5SMXybsi}jmSUK}XKjIF|߭XKX̼ԕ^XL6 o7 z#;7gk^vq,E1f2ފx溢^Pr|L2SL,eg6,j2w;9[UT;0]8~Z90WKجg|wa͵xR""/M'[5Et ,ETbTb^m^ U-jߒarKW[U.Kvѓ1ٚ-b^kՎ%ݦ1^(XuF,=g:֬eՕU+yaҚ󶰊C|f=bt;ݬdsC3gg/= ݢ%(kE1o3c\a0^k)^[8;56;d̩KmTNljkV0dIr!X[̼6X\!I||&,+{4-NeMZVT, 0ܲ>c7XK{Tsa~tkU^iFrәN9*d2|on9'mk; j갪^[y'_f0wؘ6W4k9be%֕QmaZUN 4᝙q;'cmMpka^.Q3EcVfgC/e;QZSLiW#rK-r!3}E4];zcTV62\bKMʑTdnjOl*pX^_+eX`A.Q1,[YaSsF6'*mҲ`m#}?L7X57̵1TL[ً*;#gU6nU3e+i}rܩ¨m+mk; iR;&FiU83wKӆvf} 읍5õWKnQjJ뱙ly'KוE'uXfe.alj谴fn683VS&:*{.E{xo׭Nv|;M*N|.3T{nwux U;/(1c,-5>X6\o(QԲSV등dLff.xScxwXY4CDblbaY[ogٱ,^RZvS`.ӳnnHXS_+ݞ4{MS9KQ:i˵T3i<"Xcjw(SprV 0w*薧}5TX]*3=tCaiU2mpf/%&j^"eieKЕthaQ3 uEW, LNc43Vv0x6OMQii,Tae v8qcy,MƨnY*q)Ɨa5DʩZ'e4Άo'Sg&60eXeTyv]1LFgS"^,0v"^[k|-o*6Z^+aNλXsMC),e(3),(쵲^]K+Xz趦KIX{ *ൺQZl)t=i-!^MS2Q]5>NxY;Z4a20^xƹtZl2"e ,>SkwHKs6K3M5C2gcM/EE3Kg;[׌VҕxK-rf3+P (Dg{)S1LF""s7s7֗# /yB&,FPQ9e2Nw{Y{aS*pDf4u_ho-xS;ż؊w|[Q/e7f41^KP#KxQyc(/]Q4TeIVPˉe(s33;-,(v^)F_y1͞P/MRrFQcKWg[i{r{5ߩ欣iymn^Mw֗)F咱1;Jix/YF"';^vUiw[T3 S6:X*[7ӵ3 ˶PS|cIU/%(DD`Cse3|$ӕLY[M2ݯN; 1+NJs8c3鲿LFr^l}] m%wM8gd,i}+Nw/Te o-WKbtNc[FV4U /T[_gKKgӔrr\NQk/j/[:^ ӭ]r朥1*Lk})w˭YWvUr뽔]jS|-2ηoӎ(Lk{rƷ2*^ R;xXx d,/Liz74ɪ42i{٧ 읆Sѕ %yZp9swՎv:jy]@ԕ9}h}Lk}b;3}Wzm2ȝ˥V/ՋMx>>zܛ̝ˉt3isMEc[McY7ܾuަu5[uݢ;y37;ZuUZLٻk0Ec[rySsܛ̝ɼܺw&gro3uynZ]}k}";_&u5fuZLlқi}NҫikTQk0Qzw.f33epՕIɈbc ɌɈbc.vRl2bɌɈ&2c&2c&2c&2c&2b˝)qI֕וЕѕҕӕԕՕ endstream endobj 1172 0 obj <>/ProcSet[/PDF/ImageB]/XObject<>>>/Subtype/Form>>stream H*w6PH/沰P0B#]C3=K sSC cSK= s#s\.}\|@.u } endstream endobj 1173 0 obj <> endobj 1174 0 obj <> endobj 1175 0 obj <> endobj 1176 0 obj <>/ExtGState<>>>/Subtype/Form>>stream Hw6PH.V0C<.}wPz1BQ*W@f : endstream endobj 1177 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text]/XObject<>>>/Subtype/Form>>stream Hl @D-sw{wI0( hES~{+v0vn",z{g~[;`ZRi '3IPm9`K 1ؔyc ٺ؋VEghIBy+'&dK[> _3 endstream endobj 1178 0 obj <> endobj 1179 0 obj <>/ExtGState<>/Font<>/ProcSet[/PDF/Text/ImageC]/Properties<>/XObject<>>>/Rotate 0/Tabs/W/Thumb 2089 0 R/TrimBox[0.0 0.0 612.0 792.0]/Type/Page>> endobj 1180 0 obj <>stream HWko_1"l q\(reC%ޙ* A$gw׹g~\}nr7ɇ5:d>qBt+)yFm3(AWh'6›(s7~mc 9,Zdr!bU,uldV$j?z +6y4 {dԔq-"?!%vmL 9-[mޖ^Ij| ɖ^L^̵7j"wb[0(R)OJ) u=?Uۮ:N M;}iwjb_&S1eB1F,na<`[F [ʊ Xru~?ܔ.-]?mO=@.==xߴ9_ s%N CGf=;{zH {j}ru7k{|>mw.r2X-܉Cic +#mC7הZS{/؞f{)ıC0@BF0,HK6lZzw^ a#sSiܝf t>Oh2qqݶ;K|j cj5('=Q{E6t>QƦE,&W?~]wJ713,2E[R:3tNooވۿ) HͧX.޼t mԃqø~~x//dQ/!DRB-f7#p-EJGfOZbXjyʒө~0DnB_Ŵك*ðyRJMx GL";ZL:k3QѴ%7bӘc0i`dCO2L-'1$pɞ;~zx^IGWW!>`lKy.cQh#"VxSˊyBɱ#*ȡxAMBSɞHɬhX8(CmPrW`2#c؁:vZvh , Vw4pdfNPF8 գTj%|&u3iD]l#JE+M!>H"M$OSTrh׬QTd)"v4 n)L`|Ǖ7}?_?bu2U.:NW\q rTYw D+cV rڰƕ*T=&v}s,zPJ͑z M`f&ZP CG"ܝ-i ~ؗErƢFÑb%+fc.BYcXM`} LM{zۣe=M fzh (B^Um.m+ Lp85bN*4>k=NTt#GOI",ݠ&up% !%eCצᣉׅq{%g^ɶm6+gAyz?>Ɔ&yD]cJfiӑ 6cfvHklpm#!QWRuGiᶓ߬)ػDAs|7L47se>$QY3,Hm }ǔj1Ӷx7uhT,6MDXTRCՖ GsEB>ylVTT*l?F|Y4ȚXTnw pKWh N@K}>X8x@x\fycU…uzMbs). ׿5uuxsTQv^vZce.k`p[l;;Rh5kc͖0x}|hӍ8Ioh:kꀔzP`}+` vV6L _Mpա^ FJ#8VHPq  Cx8%i.X)|H% uY! xhL|}کn6k6hf*~tH0ppI3p5;6S?",CQ6(kT‡%G-φtrNO#fZB5zkiM*IVmޮ̯:Se9],@юjG(Vl#d,YVLyrMXk8f+gs^r!4ƋDA 2FxۑkRF"*I#ǡ{_@.^Ԧ6舾}TWj+;CI o-^TKdb"(̴!!}fF[ MD6vGW J5jBeHx%("ws%@վyj|;jO{IҰ;P4SNܬ-FH̕ݠHTΟcPP9;-z 4_sM95udsbIS6\iȹ3S&)j"ۦx!lЀL u~Ӂ˧Tw7 w740śa3U4֛6%a՝@'ҡQ] Oclͫ,JMn413&:D_]jw8[=f1Ee "&߿ZS|Y2ev sNK"|e$M(;ͮp gy3} ߧ1<@>5/v3u¼4\?߿.>R!߫ c8Xn^/zff?q&fT};vؑ }8XJ.Sϕǰ`!ukҍ>Alk9 НGWf[K r^kӟmUf$ uy`%Rqw;B!/2%C'F\ ^FX+Sm]en9ָb1~yR5HY=LLյ%D7|Pú x`P {w M sDe ht,t5&vGjیG4ƶԒ"O`502Ճ i~Bosid(m~/?X|p~oD`yp{}mW$xӗm=LbHE6dR`m7gJm5ʳL?~FNDkR^a{+R?||Y4ښ_U! {YnɩBίMۮ-U]j$AEjyX *jZˊ"l?xp9=mYi)„MkOvx'Ηh`䰬KwmŠcgi!//{! YWQsm5;i6Ys68jZۼb} + iݹ׵1{%ba3Ak:Oc z+a/8%q> 5Qbbg H,@v \Agبfw{R/]Xms5^BNɉ3+h};č@95>*ȕsOW?mrbYp͖c"Gy ;~Lve9, ){*iBG7)PLihDYx5M~-7m\ԝ1& *roLVA_5'& p`YINe֪V.^]=3( La~ɛhldΖnpڪ+V(K$vRF[7p &:)Bw܆3 6(u6帞Y6lj|{9TI(D1P?ٶxr+*|FjM/a|$n{Olm, rH\ukEfAE4#FErxr j^_e1d{ybQ,N}Yzdb(QVC$ɬv#U2|;E 7s}+Y_qԉ7}{'Njt*%X %LqO%Mod-oi8p%1TH:QI}VFH{;7Ʀ)Uo^3#6}@KnùK$cf9l*9,kOQ,0y T۰{I6dzc&@SuBH&PZ?m`Į(yV"= +:bkӱ:]dn*i(LFՕ|!UA%A {Hc5G%KڍB{2,NX8tI+ l: ß^{)`gefhv`(rrU VS ?ݎtLh~c+}8U#p(ִ͈u,iXn78ϿM[Z;:NOG7 oz0]Dnǁg^^L\p!le 9\yj̎f=Ud*|u޺/h~Ŭj (v?IUFl0,56Q3}^7_YGy$r#}B7'y9A8q#|RT=a{ZtI N5V,VPmqcK^ugps8m#g gKͫwgLz8,kctYUM1ys->YT}p /GăL ;Q@/4!yNhƭü8;M*hu;qjEta c-_LE6]m"ܙ]e?Ӻb~nPkn|Yj6xvEK hV3Kԓ%tG[8^|iدIcG>`MAdBIhW+1q%;.aD9r൉ +%]=ZՋ) )A71S/WcgrȔ67$pP}&t|Si3yCq Z{;s-?ͦW